ID: 933525048

View in Genome Browser
Species Human (GRCh38)
Location 2:83426609-83426631
Sequence CCAAGGTTCTGAAAGAGTCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933525041_933525048 4 Left 933525041 2:83426582-83426604 CCAAGCCTATCCTTTACAAGAAG No data
Right 933525048 2:83426609-83426631 CCAAGGTTCTGAAAGAGTCAAGG No data
933525040_933525048 5 Left 933525040 2:83426581-83426603 CCCAAGCCTATCCTTTACAAGAA No data
Right 933525048 2:83426609-83426631 CCAAGGTTCTGAAAGAGTCAAGG No data
933525042_933525048 -1 Left 933525042 2:83426587-83426609 CCTATCCTTTACAAGAAGTACCC No data
Right 933525048 2:83426609-83426631 CCAAGGTTCTGAAAGAGTCAAGG No data
933525039_933525048 20 Left 933525039 2:83426566-83426588 CCATGTGAAACTTTACCCAAGCC No data
Right 933525048 2:83426609-83426631 CCAAGGTTCTGAAAGAGTCAAGG No data
933525043_933525048 -6 Left 933525043 2:83426592-83426614 CCTTTACAAGAAGTACCCCAAGG No data
Right 933525048 2:83426609-83426631 CCAAGGTTCTGAAAGAGTCAAGG No data
933525038_933525048 30 Left 933525038 2:83426556-83426578 CCATGGACAGCCATGTGAAACTT No data
Right 933525048 2:83426609-83426631 CCAAGGTTCTGAAAGAGTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933525048 Original CRISPR CCAAGGTTCTGAAAGAGTCA AGG Intergenic
No off target data available for this crispr