ID: 933525818

View in Genome Browser
Species Human (GRCh38)
Location 2:83437285-83437307
Sequence CACATTGACCTCCCTCAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933525818_933525820 1 Left 933525818 2:83437285-83437307 CCTGTCTGAGGGAGGTCAATGTG No data
Right 933525820 2:83437309-83437331 TTTAAGCTCTTTTACAGAGGAGG No data
933525818_933525822 23 Left 933525818 2:83437285-83437307 CCTGTCTGAGGGAGGTCAATGTG No data
Right 933525822 2:83437331-83437353 GAAACTAAGGTTAGACGAACTGG No data
933525818_933525819 -2 Left 933525818 2:83437285-83437307 CCTGTCTGAGGGAGGTCAATGTG No data
Right 933525819 2:83437306-83437328 TGATTTAAGCTCTTTTACAGAGG No data
933525818_933525821 10 Left 933525818 2:83437285-83437307 CCTGTCTGAGGGAGGTCAATGTG No data
Right 933525821 2:83437318-83437340 TTTTACAGAGGAGGAAACTAAGG 0: 4
1: 262
2: 2100
3: 7599
4: 15592

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933525818 Original CRISPR CACATTGACCTCCCTCAGAC AGG (reversed) Intergenic
No off target data available for this crispr