ID: 933532744

View in Genome Browser
Species Human (GRCh38)
Location 2:83531092-83531114
Sequence TCCCTCTGTAGAGGGAGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933532744_933532747 8 Left 933532744 2:83531092-83531114 CCAGCACTCCCTCTACAGAGGGA No data
Right 933532747 2:83531123-83531145 ACAAATTTTCCTTTGTTTTATGG 0: 26
1: 17
2: 18
3: 83
4: 931

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933532744 Original CRISPR TCCCTCTGTAGAGGGAGTGC TGG (reversed) Intergenic
No off target data available for this crispr