ID: 933532879

View in Genome Browser
Species Human (GRCh38)
Location 2:83532876-83532898
Sequence TGTTAGCTTGATCTCCTGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933532876_933532879 8 Left 933532876 2:83532845-83532867 CCATACCATGAATGTGGTTTGAG No data
Right 933532879 2:83532876-83532898 TGTTAGCTTGATCTCCTGAGAGG No data
933532877_933532879 3 Left 933532877 2:83532850-83532872 CCATGAATGTGGTTTGAGTTACA No data
Right 933532879 2:83532876-83532898 TGTTAGCTTGATCTCCTGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933532879 Original CRISPR TGTTAGCTTGATCTCCTGAG AGG Intergenic
No off target data available for this crispr