ID: 933534237

View in Genome Browser
Species Human (GRCh38)
Location 2:83552265-83552287
Sequence CTGTGTTAGTTTGAGGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933534230_933534237 19 Left 933534230 2:83552223-83552245 CCCACTTACGAGTGAGAACCTGC 0: 4
1: 201
2: 4051
3: 17249
4: 24388
Right 933534237 2:83552265-83552287 CTGTGTTAGTTTGAGGAGGATGG No data
933534233_933534237 1 Left 933534233 2:83552241-83552263 CCTGCAGTGTTTGGTTTTCTGTT 0: 20
1: 55
2: 111
3: 201
4: 680
Right 933534237 2:83552265-83552287 CTGTGTTAGTTTGAGGAGGATGG No data
933534231_933534237 18 Left 933534231 2:83552224-83552246 CCACTTACGAGTGAGAACCTGCA 0: 2
1: 114
2: 2436
3: 8778
4: 17921
Right 933534237 2:83552265-83552287 CTGTGTTAGTTTGAGGAGGATGG No data
933534229_933534237 20 Left 933534229 2:83552222-83552244 CCCCACTTACGAGTGAGAACCTG No data
Right 933534237 2:83552265-83552287 CTGTGTTAGTTTGAGGAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933534237 Original CRISPR CTGTGTTAGTTTGAGGAGGA TGG Intergenic
No off target data available for this crispr