ID: 933538128

View in Genome Browser
Species Human (GRCh38)
Location 2:83603034-83603056
Sequence CTGCGGGACTAGAATTGTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933538128_933538134 13 Left 933538128 2:83603034-83603056 CCTTCACAATTCTAGTCCCGCAG No data
Right 933538134 2:83603070-83603092 CGCTCATATGCCCAATACGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933538128 Original CRISPR CTGCGGGACTAGAATTGTGA AGG (reversed) Intergenic
No off target data available for this crispr