ID: 933544128

View in Genome Browser
Species Human (GRCh38)
Location 2:83688397-83688419
Sequence ATGTTCTTCCTAATGACAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933544128_933544132 18 Left 933544128 2:83688397-83688419 CCATTTGTCATTAGGAAGAACAT No data
Right 933544132 2:83688438-83688460 AACGTAAAAGTTTTTGTTCCTGG No data
933544128_933544130 -9 Left 933544128 2:83688397-83688419 CCATTTGTCATTAGGAAGAACAT No data
Right 933544130 2:83688411-83688433 GAAGAACATTGTACTGAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933544128 Original CRISPR ATGTTCTTCCTAATGACAAA TGG (reversed) Intergenic
No off target data available for this crispr