ID: 933552653

View in Genome Browser
Species Human (GRCh38)
Location 2:83793999-83794021
Sequence CAGAGCAAAGAACAGGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933552650_933552653 4 Left 933552650 2:83793972-83793994 CCTGAGGTCATAGGTGGATCTTT 0: 158
1: 377
2: 219
3: 116
4: 140
Right 933552653 2:83793999-83794021 CAGAGCAAAGAACAGGAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933552653 Original CRISPR CAGAGCAAAGAACAGGAGGA TGG Intergenic
No off target data available for this crispr