ID: 933554057

View in Genome Browser
Species Human (GRCh38)
Location 2:83809907-83809929
Sequence TGTACTTCCAGTACTGTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933554054_933554057 -1 Left 933554054 2:83809885-83809907 CCAGGCATGGTTGTCTCACACAT No data
Right 933554057 2:83809907-83809929 TGTACTTCCAGTACTGTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933554057 Original CRISPR TGTACTTCCAGTACTGTGGG AGG Intergenic
No off target data available for this crispr