ID: 933555578

View in Genome Browser
Species Human (GRCh38)
Location 2:83826502-83826524
Sequence CAGTAGGACCAGAGTCCCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933555576_933555578 5 Left 933555576 2:83826474-83826496 CCATAGCATCTAAGGAAATGAAA No data
Right 933555578 2:83826502-83826524 CAGTAGGACCAGAGTCCCAGAGG No data
933555574_933555578 30 Left 933555574 2:83826449-83826471 CCACAAAGGCAGTTAATTCTCTA No data
Right 933555578 2:83826502-83826524 CAGTAGGACCAGAGTCCCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933555578 Original CRISPR CAGTAGGACCAGAGTCCCAG AGG Intergenic
No off target data available for this crispr