ID: 933557918

View in Genome Browser
Species Human (GRCh38)
Location 2:83853403-83853425
Sequence GCTGAGTGAATGATTTTTAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933557918_933557921 17 Left 933557918 2:83853403-83853425 CCACTAAAAATCATTCACTCAGC No data
Right 933557921 2:83853443-83853465 AATAGTAATATGGTCTTAGAGGG No data
933557918_933557920 16 Left 933557918 2:83853403-83853425 CCACTAAAAATCATTCACTCAGC No data
Right 933557920 2:83853442-83853464 TAATAGTAATATGGTCTTAGAGG No data
933557918_933557919 7 Left 933557918 2:83853403-83853425 CCACTAAAAATCATTCACTCAGC No data
Right 933557919 2:83853433-83853455 ATAAGAAAATAATAGTAATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933557918 Original CRISPR GCTGAGTGAATGATTTTTAG TGG (reversed) Intergenic
No off target data available for this crispr