ID: 933559276

View in Genome Browser
Species Human (GRCh38)
Location 2:83872071-83872093
Sequence GATCCAGGAGTGGCCAACCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 2, 1: 4, 2: 1, 3: 14, 4: 132}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933559276 Original CRISPR GATCCAGGAGTGGCCAACCC AGG Intergenic
900079821 1:847534-847556 GTTCCATGAGTGACCAGCCCAGG - Intergenic
900300621 1:1975007-1975029 GATCCTCGCGTGGCCAGCCCCGG - Intronic
900506405 1:3031724-3031746 GAGCCAGGAATGGCCACCTCTGG - Intergenic
900556807 1:3284777-3284799 GAGCCTGGGGTGGCCAAGCCTGG + Intronic
902975834 1:20087866-20087888 GAGCCCCCAGTGGCCAACCCTGG + Intronic
903671695 1:25039755-25039777 GAGCCAGGTGTGGCCAAATCAGG + Intergenic
904836672 1:33342163-33342185 GATGAAGGAGAGGCCAAGCCAGG + Intronic
905302932 1:36997865-36997887 GAGCCAGAAGTGGCCATACCAGG + Intronic
908342505 1:63196265-63196287 GATCAAGGAGTGGCAAAGCTTGG + Intergenic
917534505 1:175864508-175864530 GCTCCAGGAGCTGCCAACTCTGG - Intergenic
919977585 1:202622988-202623010 AATCCAGGAGTTGACAACTCAGG - Intronic
922301076 1:224301376-224301398 GATACAGGAGTGACCATTCCTGG + Intronic
1063184923 10:3642078-3642100 GATCAAGGATTGGCCAATCATGG + Intergenic
1065298823 10:24302313-24302335 AATCCAGGAGTGGCCAACCCAGG - Intronic
1067844406 10:49708548-49708570 GATCCAGGCCTGGCCAACCCAGG - Exonic
1071713947 10:88076420-88076442 GATGCAGGGGTGGCCAACAGTGG + Intergenic
1074063984 10:109995712-109995734 AATCCAAGAGTGGCCAAATCAGG - Intergenic
1077104078 11:834426-834448 GAGAGAGGAGTGGCCAAGCCCGG - Intronic
1077147274 11:1051869-1051891 GGTCCAGGAGTGGAGAACCCAGG - Intergenic
1081772572 11:45658967-45658989 GATCCAGGAGTCTCCAGCCTGGG + Intronic
1083083961 11:60123567-60123589 AATCTAGGAATGGCCAACCTGGG + Intergenic
1083879443 11:65540808-65540830 GATCCGGGCGAGCCCAACCCGGG + Intronic
1083889908 11:65590521-65590543 GATCCAGGAGTGGTTCACCCTGG + Exonic
1083895001 11:65615589-65615611 GACCCAGGCGTTGCCAACCCAGG - Intronic
1084389011 11:68862697-68862719 GTTCCTGGAGGGGCCAGCCCAGG + Intergenic
1086863005 11:91947415-91947437 GAGTCAGGAGGGGCCACCCCTGG + Intergenic
1088543821 11:110940125-110940147 GAATTAGGTGTGGCCAACCCAGG - Intergenic
1088812255 11:113399742-113399764 GATGCAGGGGTGTCCAGCCCTGG - Exonic
1091993571 12:4975594-4975616 CATCCTGGAGAGGCCAACCAAGG - Intergenic
1092239960 12:6830299-6830321 GATCCAGGGGTTGCCAAACTGGG - Intronic
1094697841 12:32839257-32839279 GATCCAGGCTTGGACAATCCAGG + Intronic
1096324553 12:50647765-50647787 GATCCATGAGTGGCACACCTGGG - Intronic
1097818357 12:64100196-64100218 GATTGATAAGTGGCCAACCCAGG - Intronic
1098901445 12:76115750-76115772 GATCCAGCAGTGAACAACCTTGG + Intergenic
1103571344 12:121847036-121847058 GATCCAGGTGAGGCCGCCCCTGG - Exonic
1104434382 12:128743987-128744009 GCTCCTGGAGAGGCCATCCCGGG - Intergenic
1105650736 13:22374195-22374217 TTTCCAGGAGAGGCCAGCCCTGG - Intergenic
1105772794 13:23629269-23629291 GAACCAGGAGTAGCCCTCCCTGG + Intronic
1111849093 13:93549561-93549583 GATCCAGGAGTGCTCAGCCTGGG - Intronic
1113721703 13:112562397-112562419 GGTCCAGGAGGGCCCAACACAGG + Intronic
1115532777 14:34342447-34342469 GATCCAGGAGTGGCCTAGAAAGG - Intronic
1116856236 14:49954911-49954933 GCTCCAGGATTGGCCAATTCAGG + Intergenic
1129389865 15:75215092-75215114 GATACAGGAGGGGCCTGCCCTGG - Intergenic
1130296900 15:82653671-82653693 GAGCCAGGAGAAGCCAACTCAGG + Intergenic
1132941894 16:2512705-2512727 GTTCCAAGAGTGGCAGACCCAGG + Intronic
1133397353 16:5458835-5458857 GTACCAGGAATGGCCAACTCTGG + Intergenic
1137512647 16:49115086-49115108 TATCCAGGACTGGCCAAAGCAGG + Intergenic
1138572534 16:57884847-57884869 ACTCCAGGAGTGCCCACCCCTGG - Intronic
1139668552 16:68475374-68475396 GATCCAGGTGTGATCAGCCCTGG + Intergenic
1141745528 16:85923475-85923497 GGTGCAGGGCTGGCCAACCCAGG + Intergenic
1144160490 17:12553001-12553023 GATCCGGGAGTGGGCAAACTAGG - Intergenic
1145909627 17:28534949-28534971 GGTCCAGGAGGGGCCAGGCCTGG - Exonic
1147561518 17:41512368-41512390 CATCCCGGAATGCCCAACCCAGG + Intergenic
1148755776 17:49972268-49972290 GATCCAGGAGTGGCCCCGCCGGG + Intronic
1149685590 17:58532728-58532750 GCCTCAGGAGAGGCCAACCCAGG + Intronic
1150271954 17:63872542-63872564 GTTCCAGGATTGGCGACCCCTGG + Intronic
1151492989 17:74443662-74443684 AACCCAGGAGTGGCCAACTTGGG - Intronic
1152034555 17:77864100-77864122 GGTCCTGGAGTGGCCCACGCCGG - Intergenic
1152165714 17:78703945-78703967 GACCCAGCAGTGTCCACCCCTGG - Intronic
1154194390 18:12254881-12254903 CTTCCAGGAGGGGCCAAGCCTGG - Intronic
1156239467 18:35238977-35238999 GATGCAGAAGTAACCAACCCTGG + Intergenic
1157128002 18:44975908-44975930 GAAGCAGTAGTGGCCAAGCCTGG + Intronic
1160149388 18:76387742-76387764 GATTCAGGAATGGCCACTCCTGG - Intronic
1160370505 18:78368886-78368908 GAGCCAGGAGAGGACAGCCCCGG + Intergenic
1165069815 19:33248797-33248819 GAGCCAGGAGGGACCAACCCAGG + Intergenic
1166777072 19:45319520-45319542 CAGACAGGAGTGGACAACCCAGG - Exonic
1167437816 19:49490063-49490085 GAGCCTGGAGTCCCCAACCCTGG - Intronic
926130722 2:10302186-10302208 GAGCCAGGAGGCGCCGACCCTGG + Intergenic
926189871 2:10720934-10720956 GAACCAGGAGGGGGAAACCCTGG - Intergenic
928117819 2:28560143-28560165 TACCAAGGAGTGGCCCACCCTGG - Intronic
929435353 2:41924702-41924724 AGGCCAGGAGAGGCCAACCCAGG - Intergenic
931647537 2:64438205-64438227 GATCCTTGGATGGCCAACCCTGG - Intergenic
933559276 2:83872071-83872093 GATCCAGGAGTGGCCAACCCAGG + Intergenic
933948617 2:87309088-87309110 GTCCCAGGAGAGGCCCACCCAGG - Intergenic
936331582 2:111552508-111552530 GTCCCAGGAGAGGCCCACCCAGG + Intergenic
937154142 2:119706710-119706732 GGTCCTGGAGTGCCTAACCCTGG - Intergenic
938128193 2:128689720-128689742 GAATCCAGAGTGGCCAACCCAGG + Intergenic
938306939 2:130262916-130262938 GAGCCAGGAGTGGGTACCCCAGG - Intergenic
938614818 2:132986898-132986920 AATCCAGGAGTGGACAATCCAGG + Intronic
938821541 2:134965390-134965412 AATCCAGGAGTGCCCAAAACGGG - Intronic
939177344 2:138764296-138764318 GATCCAGGGGTCTCCAAACCTGG + Intronic
939855851 2:147357711-147357733 GATCCCTGAGTGACCCACCCTGG + Intergenic
942460249 2:176163453-176163475 GACCCAGAAGTGGGCAGCCCAGG + Intronic
942960840 2:181828510-181828532 AATCCGGAAGTGGCCAACTCAGG - Intergenic
947549745 2:231037743-231037765 GAGCCAGGCGCGGCCAAGCCGGG + Exonic
947623032 2:231603270-231603292 GATCCAGGCTGGGCCAACCAGGG - Intergenic
1170187610 20:13608752-13608774 GATCAAGGATTGGCCAACTATGG - Intronic
1173982102 20:47232479-47232501 AACCCAGGAGTGGCCAGCCTGGG + Intronic
1175229585 20:57465324-57465346 GAGCCAGGGTTGGTCAACCCGGG - Intergenic
1179166998 21:38943175-38943197 CATCCAAGAGTGGGCGACCCAGG - Intergenic
1181045671 22:20213162-20213184 GATCCAGGATTGGCAAAGCAGGG - Intergenic
1181579014 22:23816649-23816671 GATGCAGGAGAGGACAACCAGGG - Intronic
1182356054 22:29722662-29722684 GTGCCAGGAATGGCCAGCCCTGG - Intronic
1182422766 22:30256563-30256585 GACCCAGGACTGGCCCACCCCGG + Intergenic
1183330487 22:37218237-37218259 GAAACAGGAGTGGCTAACACAGG - Intergenic
1183588543 22:38767120-38767142 GGACCAGCAGTGGCCATCCCTGG - Intronic
1184262164 22:43324652-43324674 TATCCAGGAGTCGCCGCCCCTGG + Intronic
1184664767 22:45982425-45982447 GATCCTTGTGTGGCCAACCAAGG - Intergenic
950142882 3:10627470-10627492 AACCCAGGACTGGCTAACCCAGG - Intronic
950374553 3:12560007-12560029 AATCCAGAACTGCCCAACCCTGG - Intronic
956836206 3:73098177-73098199 GGTCCAGGAGTGAGCATCCCAGG - Intergenic
961362302 3:126375782-126375804 GATCCAGGAGGGGCCATCAGGGG + Intergenic
961394736 3:126578865-126578887 GATCCTTGAGTGGGCGACCCTGG + Intronic
966139639 3:176741178-176741200 GATATAGGAGAGTCCAACCCAGG - Intergenic
966712724 3:182986014-182986036 CATCTAGGAGTGGCCAAGCTGGG - Intergenic
968438709 4:610492-610514 GAGCCAGGAGGGACCACCCCAGG + Intergenic
969668299 4:8574956-8574978 GCCCCAGGGGTGGCCCACCCTGG - Intronic
970962677 4:21891174-21891196 AATCCAAGAGTGGTCAACCCAGG - Intronic
974880719 4:67753841-67753863 GATCCAGGCCAGGCCAACCATGG + Exonic
975719177 4:77233846-77233868 AATCCAAGAGTGGCCAACCTGGG + Intronic
984764573 4:183389954-183389976 GAACAAGCTGTGGCCAACCCGGG + Intergenic
985404681 4:189625893-189625915 GCTTCAGGAGTGCCCATCCCAGG - Intergenic
999389677 5:151180933-151180955 GAACCACGAGTGGGCTACCCAGG + Intergenic
999773501 5:154793091-154793113 GATTCAGGAGTTGCCATACCAGG - Intronic
999845061 5:155470213-155470235 AATCTGGGAGTGGCCAACCCAGG - Intergenic
1000156046 5:158552808-158552830 GATCCAGGACTAGCTAACTCCGG + Intergenic
1006747722 6:36356602-36356624 GATCCAGGATAGGCCAATCAGGG - Intronic
1007448783 6:41927408-41927430 GGACGAGGAGTGGCCCACCCTGG + Exonic
1008423203 6:51327150-51327172 GATCCAGGCCTGGCCAACCATGG + Intergenic
1009900469 6:69802725-69802747 AGTCTAGAAGTGGCCAACCCAGG - Intergenic
1011501292 6:87992889-87992911 GTTCCAGGAGTGCCTGACCCAGG + Intergenic
1012866323 6:104622608-104622630 GGTGCAGGAGAGGCCAATCCAGG + Intergenic
1017981080 6:159401643-159401665 AATCCAGGAGTGGCCAACCCAGG - Intergenic
1023112385 7:36826778-36826800 GATCCAGGACTGGCCAAGCAAGG - Intergenic
1024728741 7:52231059-52231081 AATACAGGAGTCCCCAACCCTGG - Intergenic
1026036425 7:66833228-66833250 TCTCCAGGGGTGGCCAAGCCAGG + Intergenic
1026037494 7:66840140-66840162 TCTCCAGGGGTGGCCAAGCCAGG + Intergenic
1026068222 7:67094786-67094808 GATCCAGGAGTGGCCAACCTGGG + Intronic
1026708699 7:72717528-72717550 GATCCAGGAGTGGCCAACCCGGG - Intronic
1030715144 7:112800704-112800726 AATCCAGGAGTGGCCAACCCAGG - Intergenic
1034028785 7:147737447-147737469 GACCCAGGAGTAGCCAAACTGGG - Intronic
1034491874 7:151397160-151397182 GATTCAGGAGGGTCCCACCCCGG - Intronic
1035525683 8:311382-311404 GTTCCATGAGTGACCAGCCCAGG + Intergenic
1037965082 8:23127897-23127919 GATGCAGAAGTGGCCACCCTGGG + Intergenic
1037967719 8:23146802-23146824 GGACCAGGAGGGGCCAACGCAGG + Intronic
1037973573 8:23192404-23192426 GATGCAGAAGTGGCCACCCTGGG - Intronic
1039502912 8:38031073-38031095 GATCCAGGAGAGGCCTGGCCTGG + Intronic
1044842270 8:96346585-96346607 GTATCAGGAGTGGCCAACCCTGG + Intergenic
1045380244 8:101616708-101616730 GATCCAGCAGTGACCAACACAGG - Intronic
1048845728 8:138602390-138602412 GAATCTGGAGGGGCCAACCCAGG - Intronic
1053283560 9:36836714-36836736 TATGCAGGAGTGCCCAAGCCAGG - Exonic
1057088505 9:92234488-92234510 GACCCAGGAATGGCCAGTCCTGG + Intronic
1060814041 9:126625586-126625608 CAGCCGGGAATGGCCAACCCTGG - Intronic
1061952855 9:133945868-133945890 GCTCCAGGTGGGGACAACCCAGG + Intronic
1062560802 9:137141035-137141057 AATCCAGGAGGGGCCATTCCTGG + Intronic
1185607163 X:1373656-1373678 GATCCAGGTGTGGGCAAGGCTGG - Intronic
1185607677 X:1376453-1376475 GATCCAGGTGTGGGCAAGGCTGG - Intronic
1197758165 X:130010578-130010600 GATCCAGAAGGGGCTAACCGAGG - Intronic
1197853405 X:130889144-130889166 GCCCCAGGTGTGGCCACCCCAGG - Intronic
1198047083 X:132913652-132913674 GATCCAGGCATGGCCATCGCTGG + Intronic
1198547384 X:137707031-137707053 AATGCAGGAGTGGACTACCCAGG - Intergenic
1200962952 Y:9011737-9011759 GAGCCAGCAGTGGCCACCCACGG - Intergenic
1201715937 Y:17043891-17043913 GAGCCAGCAGTGGCAACCCCTGG + Intergenic