ID: 933572172

View in Genome Browser
Species Human (GRCh38)
Location 2:84026521-84026543
Sequence AGACTTGGAATAGTATTGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933572169_933572172 -10 Left 933572169 2:84026508-84026530 CCTCGCCTCGGAAAGACTTGGAA No data
Right 933572172 2:84026521-84026543 AGACTTGGAATAGTATTGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933572172 Original CRISPR AGACTTGGAATAGTATTGAT GGG Intergenic
No off target data available for this crispr