ID: 933573096

View in Genome Browser
Species Human (GRCh38)
Location 2:84036409-84036431
Sequence ATCTTTATTTACTTTGTGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933573091_933573096 9 Left 933573091 2:84036377-84036399 CCTCCAGTTTCCTACAGGAGCCG No data
Right 933573096 2:84036409-84036431 ATCTTTATTTACTTTGTGTCAGG No data
933573090_933573096 10 Left 933573090 2:84036376-84036398 CCCTCCAGTTTCCTACAGGAGCC No data
Right 933573096 2:84036409-84036431 ATCTTTATTTACTTTGTGTCAGG No data
933573093_933573096 -1 Left 933573093 2:84036387-84036409 CCTACAGGAGCCGTAACGCCACA No data
Right 933573096 2:84036409-84036431 ATCTTTATTTACTTTGTGTCAGG No data
933573092_933573096 6 Left 933573092 2:84036380-84036402 CCAGTTTCCTACAGGAGCCGTAA No data
Right 933573096 2:84036409-84036431 ATCTTTATTTACTTTGTGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933573096 Original CRISPR ATCTTTATTTACTTTGTGTC AGG Intergenic
No off target data available for this crispr