ID: 933575938

View in Genome Browser
Species Human (GRCh38)
Location 2:84067772-84067794
Sequence TGTTACTATTGCAATTGTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933575937_933575938 -5 Left 933575937 2:84067754-84067776 CCTATGAGTGATCTTGGGTGTTA No data
Right 933575938 2:84067772-84067794 TGTTACTATTGCAATTGTGTTGG No data
933575934_933575938 10 Left 933575934 2:84067739-84067761 CCTATGTTATGGTGACCTATGAG No data
Right 933575938 2:84067772-84067794 TGTTACTATTGCAATTGTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933575938 Original CRISPR TGTTACTATTGCAATTGTGT TGG Intergenic
No off target data available for this crispr