ID: 933577351

View in Genome Browser
Species Human (GRCh38)
Location 2:84084460-84084482
Sequence AATTCTGGGGATCCACAATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933577351_933577357 -5 Left 933577351 2:84084460-84084482 CCAAATTGTGGATCCCCAGAATT No data
Right 933577357 2:84084478-84084500 GAATTGTTGGGCAGACTTTCAGG No data
933577351_933577358 -4 Left 933577351 2:84084460-84084482 CCAAATTGTGGATCCCCAGAATT No data
Right 933577358 2:84084479-84084501 AATTGTTGGGCAGACTTTCAGGG No data
933577351_933577360 27 Left 933577351 2:84084460-84084482 CCAAATTGTGGATCCCCAGAATT No data
Right 933577360 2:84084510-84084532 AGGAGAAAATAATGCCAATGAGG No data
933577351_933577359 7 Left 933577351 2:84084460-84084482 CCAAATTGTGGATCCCCAGAATT No data
Right 933577359 2:84084490-84084512 AGACTTTCAGGGTGCTACAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933577351 Original CRISPR AATTCTGGGGATCCACAATT TGG (reversed) Intergenic
No off target data available for this crispr