ID: 933579225

View in Genome Browser
Species Human (GRCh38)
Location 2:84105797-84105819
Sequence CTCTCGGCAGAAACTCTACA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933579220_933579225 11 Left 933579220 2:84105763-84105785 CCACAAAGGGAAGCCCATCAGAC 0: 5864
1: 2938
2: 903
3: 329
4: 257
Right 933579225 2:84105797-84105819 CTCTCGGCAGAAACTCTACAAGG No data
933579219_933579225 12 Left 933579219 2:84105762-84105784 CCCACAAAGGGAAGCCCATCAGA 0: 4645
1: 4506
2: 1938
3: 878
4: 1128
Right 933579225 2:84105797-84105819 CTCTCGGCAGAAACTCTACAAGG No data
933579222_933579225 -2 Left 933579222 2:84105776-84105798 CCCATCAGACTAACAGCGGATCT 0: 2475
1: 4705
2: 2679
3: 2091
4: 1694
Right 933579225 2:84105797-84105819 CTCTCGGCAGAAACTCTACAAGG No data
933579223_933579225 -3 Left 933579223 2:84105777-84105799 CCATCAGACTAACAGCGGATCTC 0: 2470
1: 4697
2: 2710
3: 1513
4: 1100
Right 933579225 2:84105797-84105819 CTCTCGGCAGAAACTCTACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933579225 Original CRISPR CTCTCGGCAGAAACTCTACA AGG Intergenic
No off target data available for this crispr