ID: 933582961

View in Genome Browser
Species Human (GRCh38)
Location 2:84147968-84147990
Sequence TCTAAGACTTTCAACTTTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933582961_933582962 8 Left 933582961 2:84147968-84147990 CCAAGAAAGTTGAAAGTCTTAGA No data
Right 933582962 2:84147999-84148021 TTTTTTCCCACCATAATCAGAGG No data
933582961_933582965 16 Left 933582961 2:84147968-84147990 CCAAGAAAGTTGAAAGTCTTAGA No data
Right 933582965 2:84148007-84148029 CACCATAATCAGAGGCAGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933582961 Original CRISPR TCTAAGACTTTCAACTTTCT TGG (reversed) Intergenic
No off target data available for this crispr