ID: 933582965

View in Genome Browser
Species Human (GRCh38)
Location 2:84148007-84148029
Sequence CACCATAATCAGAGGCAGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933582960_933582965 17 Left 933582960 2:84147967-84147989 CCCAAGAAAGTTGAAAGTCTTAG No data
Right 933582965 2:84148007-84148029 CACCATAATCAGAGGCAGCTTGG No data
933582961_933582965 16 Left 933582961 2:84147968-84147990 CCAAGAAAGTTGAAAGTCTTAGA No data
Right 933582965 2:84148007-84148029 CACCATAATCAGAGGCAGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933582965 Original CRISPR CACCATAATCAGAGGCAGCT TGG Intergenic
No off target data available for this crispr