ID: 933586447

View in Genome Browser
Species Human (GRCh38)
Location 2:84184840-84184862
Sequence GATCTCAGTGGGTCTAGGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933586447_933586451 14 Left 933586447 2:84184840-84184862 CCATTCCTAGACCCACTGAGATC No data
Right 933586451 2:84184877-84184899 GATTTGTGAACCAACATGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933586447 Original CRISPR GATCTCAGTGGGTCTAGGAA TGG (reversed) Intergenic
No off target data available for this crispr