ID: 933591138

View in Genome Browser
Species Human (GRCh38)
Location 2:84233862-84233884
Sequence ATGGGAAGAATCAGAATTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933591138_933591141 -9 Left 933591138 2:84233862-84233884 CCCAGAATTCTGATTCTTCCCAT No data
Right 933591141 2:84233876-84233898 TCTTCCCATGGACATAACCATGG No data
933591138_933591145 5 Left 933591138 2:84233862-84233884 CCCAGAATTCTGATTCTTCCCAT No data
Right 933591145 2:84233890-84233912 TAACCATGGCAAAAAAGTGGTGG No data
933591138_933591144 2 Left 933591138 2:84233862-84233884 CCCAGAATTCTGATTCTTCCCAT No data
Right 933591144 2:84233887-84233909 ACATAACCATGGCAAAAAAGTGG No data
933591138_933591148 15 Left 933591138 2:84233862-84233884 CCCAGAATTCTGATTCTTCCCAT No data
Right 933591148 2:84233900-84233922 AAAAAAGTGGTGGGTCAGCATGG No data
933591138_933591146 6 Left 933591138 2:84233862-84233884 CCCAGAATTCTGATTCTTCCCAT No data
Right 933591146 2:84233891-84233913 AACCATGGCAAAAAAGTGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933591138 Original CRISPR ATGGGAAGAATCAGAATTCT GGG (reversed) Intergenic
No off target data available for this crispr