ID: 933596522

View in Genome Browser
Species Human (GRCh38)
Location 2:84288667-84288689
Sequence CTCAGGCAACATCCTGAGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933596522_933596526 -7 Left 933596522 2:84288667-84288689 CCACCCTCAGGATGTTGCCTGAG No data
Right 933596526 2:84288683-84288705 GCCTGAGGACACCCTCTTGCTGG No data
933596522_933596528 -6 Left 933596522 2:84288667-84288689 CCACCCTCAGGATGTTGCCTGAG No data
Right 933596528 2:84288684-84288706 CCTGAGGACACCCTCTTGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933596522 Original CRISPR CTCAGGCAACATCCTGAGGG TGG (reversed) Intergenic
No off target data available for this crispr