ID: 933596526

View in Genome Browser
Species Human (GRCh38)
Location 2:84288683-84288705
Sequence GCCTGAGGACACCCTCTTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933596522_933596526 -7 Left 933596522 2:84288667-84288689 CCACCCTCAGGATGTTGCCTGAG No data
Right 933596526 2:84288683-84288705 GCCTGAGGACACCCTCTTGCTGG No data
933596516_933596526 26 Left 933596516 2:84288634-84288656 CCAAAGCTCCCCTGCAGGGTCAG No data
Right 933596526 2:84288683-84288705 GCCTGAGGACACCCTCTTGCTGG No data
933596520_933596526 16 Left 933596520 2:84288644-84288666 CCTGCAGGGTCAGGCTGTAGCTA No data
Right 933596526 2:84288683-84288705 GCCTGAGGACACCCTCTTGCTGG No data
933596518_933596526 18 Left 933596518 2:84288642-84288664 CCCCTGCAGGGTCAGGCTGTAGC No data
Right 933596526 2:84288683-84288705 GCCTGAGGACACCCTCTTGCTGG No data
933596519_933596526 17 Left 933596519 2:84288643-84288665 CCCTGCAGGGTCAGGCTGTAGCT No data
Right 933596526 2:84288683-84288705 GCCTGAGGACACCCTCTTGCTGG No data
933596524_933596526 -10 Left 933596524 2:84288670-84288692 CCCTCAGGATGTTGCCTGAGGAC No data
Right 933596526 2:84288683-84288705 GCCTGAGGACACCCTCTTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933596526 Original CRISPR GCCTGAGGACACCCTCTTGC TGG Intergenic
No off target data available for this crispr