ID: 933599520

View in Genome Browser
Species Human (GRCh38)
Location 2:84315619-84315641
Sequence CTCATTAAGACACTTGTACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933599520_933599531 4 Left 933599520 2:84315619-84315641 CCTGGTACAAGTGTCTTAATGAG No data
Right 933599531 2:84315646-84315668 GTTGACAGCTCGATGGTGGGGGG No data
933599520_933599527 0 Left 933599520 2:84315619-84315641 CCTGGTACAAGTGTCTTAATGAG No data
Right 933599527 2:84315642-84315664 GGGGGTTGACAGCTCGATGGTGG No data
933599520_933599532 7 Left 933599520 2:84315619-84315641 CCTGGTACAAGTGTCTTAATGAG No data
Right 933599532 2:84315649-84315671 GACAGCTCGATGGTGGGGGGTGG No data
933599520_933599526 -3 Left 933599520 2:84315619-84315641 CCTGGTACAAGTGTCTTAATGAG No data
Right 933599526 2:84315639-84315661 GAGGGGGGTTGACAGCTCGATGG No data
933599520_933599534 23 Left 933599520 2:84315619-84315641 CCTGGTACAAGTGTCTTAATGAG No data
Right 933599534 2:84315665-84315687 GGGGTGGGTACAAATACAAACGG No data
933599520_933599528 1 Left 933599520 2:84315619-84315641 CCTGGTACAAGTGTCTTAATGAG No data
Right 933599528 2:84315643-84315665 GGGGTTGACAGCTCGATGGTGGG No data
933599520_933599529 2 Left 933599520 2:84315619-84315641 CCTGGTACAAGTGTCTTAATGAG No data
Right 933599529 2:84315644-84315666 GGGTTGACAGCTCGATGGTGGGG No data
933599520_933599533 8 Left 933599520 2:84315619-84315641 CCTGGTACAAGTGTCTTAATGAG No data
Right 933599533 2:84315650-84315672 ACAGCTCGATGGTGGGGGGTGGG No data
933599520_933599530 3 Left 933599520 2:84315619-84315641 CCTGGTACAAGTGTCTTAATGAG No data
Right 933599530 2:84315645-84315667 GGTTGACAGCTCGATGGTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933599520 Original CRISPR CTCATTAAGACACTTGTACC AGG (reversed) Intergenic
No off target data available for this crispr