ID: 933599925

View in Genome Browser
Species Human (GRCh38)
Location 2:84318719-84318741
Sequence AGCTCCCAGTGTGTGTTTTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933599925_933599926 -6 Left 933599925 2:84318719-84318741 CCTCAAAACACACACTGGGAGCT No data
Right 933599926 2:84318736-84318758 GGAGCTTAGAGCCTGCCCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933599925 Original CRISPR AGCTCCCAGTGTGTGTTTTG AGG (reversed) Intergenic
No off target data available for this crispr