ID: 933608808

View in Genome Browser
Species Human (GRCh38)
Location 2:84412832-84412854
Sequence GGATGCAAATAGAGGTATCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933608808_933608812 0 Left 933608808 2:84412832-84412854 CCTAGATACCTCTATTTGCATCC No data
Right 933608812 2:84412855-84412877 TGCTCCTATTGCCTTGAGTTGGG No data
933608808_933608811 -1 Left 933608808 2:84412832-84412854 CCTAGATACCTCTATTTGCATCC No data
Right 933608811 2:84412854-84412876 CTGCTCCTATTGCCTTGAGTTGG No data
933608808_933608815 17 Left 933608808 2:84412832-84412854 CCTAGATACCTCTATTTGCATCC No data
Right 933608815 2:84412872-84412894 GTTGGGTGAATGCTTCCCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933608808 Original CRISPR GGATGCAAATAGAGGTATCT AGG (reversed) Intergenic
No off target data available for this crispr