ID: 933610902

View in Genome Browser
Species Human (GRCh38)
Location 2:84434116-84434138
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1454
Summary {0: 3, 1: 37, 2: 380, 3: 488, 4: 546}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933610902_933610905 19 Left 933610902 2:84434116-84434138 CCATGCATGTATAGCCTGCAGAA 0: 3
1: 37
2: 380
3: 488
4: 546
Right 933610905 2:84434158-84434180 CTTTTACTTATAAATCATCCAGG 0: 1
1: 0
2: 5
3: 44
4: 371

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933610902 Original CRISPR TTCTGCAGGCTATACATGCA TGG (reversed) Intronic
900499824 1:2998543-2998565 TTCTGCAAGCTGTACAGGAAGGG + Intergenic
900566341 1:3333950-3333972 TCCTGCAGGCTGTATAAGCATGG - Intronic
901136341 1:6999324-6999346 TTTGGCAGGCTGTACAAGCATGG + Intronic
901335105 1:8442534-8442556 TTCTGCAGGCTGTACAAGCACGG - Intronic
901574658 1:10191255-10191277 TTCTGCAGGCTGTACAAGGGTGG + Intergenic
901683801 1:10932117-10932139 TTCTACAGGCTGTGCAAGCATGG - Intergenic
902111119 1:14079094-14079116 TTCTGCGGGCTGTACAAGCATGG + Intergenic
902138986 1:14335627-14335649 TTTTGCAGGCCATACAAGTATGG - Intergenic
902322551 1:15678614-15678636 TTCTGCAGGCTGCACAAGCATGG + Intergenic
902655952 1:17868499-17868521 TCCTGCGGGCTGTACAAGCATGG - Intergenic
902745004 1:18467926-18467948 TTCTGCAGGGTGTACAAGCATGG + Intergenic
902789337 1:18755659-18755681 TTCTGCAAGCTATACAAGCATGG - Intergenic
904371505 1:30050363-30050385 TTCTGCAGGCTGTATAAGCATGG + Intergenic
904544458 1:31257553-31257575 TTCTGCAGGCTGTACAAAAAGGG - Intergenic
904778559 1:32927059-32927081 TTCTGTAGGCTGTGCAAGCATGG + Intergenic
904887556 1:33752485-33752507 TTCTGCAGGCTGTACAGGCATGG - Intronic
904887819 1:33754455-33754477 TTCTGCAGGCTGTACAGGCATGG - Intronic
905540132 1:38754049-38754071 TTCTGCAGTCTTTACAAGCATGG - Intergenic
905834579 1:41106450-41106472 TTCTGCAGGCTGTATAAACACGG - Intronic
906570640 1:46835464-46835486 TTCTGCAGGCTGTAAAAGCCTGG + Intergenic
906753534 1:48287716-48287738 TTCTGCAGGCTGTACAAGCATGG - Intergenic
907023240 1:51089099-51089121 TTCTGCAGGCTATACAAGCATGG + Intergenic
907253453 1:53159600-53159622 ATCTGCAGGCTATAAAAGCATGG - Intergenic
907733444 1:57089401-57089423 TTCTTCGGGCTGTACAAGCAGGG + Intronic
907960463 1:59275387-59275409 TTTTGCAGGCTGTACAGGCATGG - Intergenic
908087148 1:60647768-60647790 TTCTGCAGGCTGTACAAGCATGG + Intergenic
908098000 1:60760754-60760776 TTCTGGAGGCTCTACCTTCAAGG + Intergenic
908396271 1:63728441-63728463 TTCTGCAGGCTGTACAAGCATGG - Intergenic
908480907 1:64538071-64538093 TGCTGCAGCCTTTACAGGCAAGG + Intronic
908492635 1:64661671-64661693 TTTTGCAGGCCCTCCATGCAAGG - Intronic
908539630 1:65110631-65110653 GTCTGCAGGCTGTGCAAGCATGG + Intergenic
908539861 1:65112079-65112101 TTCTGCAGGCTGTATAAGCATGG + Intergenic
908865651 1:68546625-68546647 TTCTGCAGACTGTACAAGCATGG + Intergenic
909060262 1:70871128-70871150 TTCTGCAGGTCACACAAGCATGG + Intronic
909231000 1:73089870-73089892 TTCTGCAGGCTGTATACGCTTGG - Intergenic
909693205 1:78434306-78434328 TTCTGGAAGCTAGACATTCAAGG + Intronic
909718203 1:78735956-78735978 TTCTGCAGGCTGTAAAAGCATGG + Intergenic
910423748 1:87099282-87099304 TTCTGCAGGATGTACAAGCATGG + Intronic
910424134 1:87101897-87101919 TTCTGCAGGCTGTGCAAGCATGG + Intronic
910509115 1:87983930-87983952 TTCTGCAGGCTGTACAAGCATGG - Intergenic
910633241 1:89379092-89379114 TTCTGCAGGCTGTACAAGCATGG + Intronic
910641903 1:89473092-89473114 TTCTGCAGGCCACACTTCCACGG + Intergenic
910645779 1:89513716-89513738 TTCTGCAGATTATACAAGCATGG + Intergenic
910738125 1:90484758-90484780 TTCTGCAGGCTGTACAAGCATGG - Intergenic
910777083 1:90887545-90887567 TTCTGTGGGCTGTACAAGCATGG - Intergenic
910833811 1:91487217-91487239 TTCTGCAGGCTGTACAAGTGTGG + Intergenic
910904012 1:92154189-92154211 TCCTGCAGGCTGTACAAGCATGG - Intergenic
911138120 1:94464977-94464999 ATCTGCAGGCTGTACAAGCATGG + Intronic
911266566 1:95751474-95751496 TTTTGCAGCCTGTACAAGCATGG - Intergenic
911468275 1:98282447-98282469 TTCTGCAGGCTGTACAAGTTTGG - Intergenic
911498336 1:98657504-98657526 TTCTGAAGCCTGTACAAGCATGG + Intergenic
911571934 1:99528061-99528083 TTCTGCAGGCTGTACATGCATGG + Intergenic
911590859 1:99746016-99746038 TTCTGCAGGCTGTACAAGCATGG - Intronic
911625548 1:100119827-100119849 TTCTGTAGGCTGTACAAGCATGG - Intronic
911799172 1:102111524-102111546 TTTTGCAGGCTGTATAGGCATGG + Intergenic
912074806 1:105860710-105860732 TTCTGCAGGCTGTATAGGAAGGG + Intergenic
912267361 1:108172393-108172415 TTCTACAGACTGTACAAGCATGG + Intronic
912582287 1:110731338-110731360 TTCTGGAGGCTAGAAATCCAAGG - Intergenic
912591896 1:110830682-110830704 TTCTGCAGGCTGTACAAGCATGG + Intergenic
912717844 1:111994559-111994581 TTCTGCAGGCTGTACAAACACGG - Intergenic
912761032 1:112367745-112367767 TTCTGTAGGCTGTACAAACATGG - Intergenic
912878560 1:113387082-113387104 TTCTGCAGGCTGTACAAGCATGG - Intergenic
913202527 1:116506810-116506832 TTCTGCAGGCTGTACAAGCAAGG - Intergenic
913330632 1:117664156-117664178 TTCTGCAGGCTGTACAAGAATGG - Intergenic
915295008 1:154914077-154914099 TTCTACAGGCTATACAAGCATGG - Intergenic
915654661 1:157349369-157349391 TTCTGCAGGCCACACAAGCATGG + Intergenic
916005964 1:160660496-160660518 TTCTGCAGGCCGTACAAACATGG - Intergenic
916014141 1:160733611-160733633 TTCTGCAAGCTGTACAAGAATGG + Intergenic
916251418 1:162742331-162742353 TTCTGCAGGCTGCACAAGCATGG + Intronic
916287910 1:163131345-163131367 TTCTGCAGGCTACACAAGCATGG - Intronic
916288163 1:163133364-163133386 TTCTGCAGGCTGTACAAGCATGG - Intronic
916352738 1:163870370-163870392 TTCTGCAGGCTGCACAAGCATGG + Intergenic
916398773 1:164422534-164422556 TTCTGCAGGCTGTGCAAGCATGG - Intergenic
916604123 1:166324268-166324290 TTCTGCAGGCTGTACAAGCATGG - Intergenic
916788974 1:168108036-168108058 TTCTGCAGGCTGTACAATTATGG + Intronic
917046004 1:170860875-170860897 TTCTACAGGCTGTACAAGCATGG - Intergenic
917172205 1:172189714-172189736 TTCTGCAGGCTGTACAAGTGTGG + Intronic
917408903 1:174737733-174737755 TTCTGCAAGCTGTACAGGCATGG + Intronic
917759451 1:178140905-178140927 TTCTGTAGGCTATGCAAGCATGG + Intronic
917766213 1:178220149-178220171 ATCTGCAGCCTATACAGGCATGG - Intronic
917806745 1:178620721-178620743 TTCTGCAGGCTGTAAAAGCATGG + Intergenic
918631129 1:186719632-186719654 TACTGTAGGCTGTACATGCATGG - Intergenic
919032259 1:192257173-192257195 TTCTGCAGGCTGTACAAGCCTGG - Intergenic
919105040 1:193139219-193139241 TGCTGGAGACTAAACATGCATGG - Intronic
919149616 1:193678981-193679003 TTCTGCAGGCTGTACAAGCATGG - Intergenic
919244863 1:194969683-194969705 TTCTGCAGGCCGTACATGGCTGG + Intergenic
919360780 1:196591336-196591358 TTCTTCAGGCTGTGCAAGCATGG - Intronic
919598154 1:199590262-199590284 TTCTACAGGCTGTACAAGAAAGG - Intergenic
919852127 1:201680075-201680097 TTCTGCAAGCTGTACAAGCAAGG + Intronic
919951511 1:202368415-202368437 TTCTGCAGGCTGCACAAGCATGG - Intronic
920163639 1:204019286-204019308 TTCTGCAGGCTGTACAAGAATGG - Intergenic
920510497 1:206548264-206548286 TTCTGCAGACGGTACAAGCATGG + Intronic
920553164 1:206882103-206882125 TTCTGCAGGCTGTACAAGTATGG - Intergenic
920573419 1:207035716-207035738 TTCTACAGGCTGTACAGGCATGG + Intronic
920890866 1:209984737-209984759 TTCTGCAGGCTGTATAAGCATGG + Intronic
920895490 1:210044767-210044789 CTCTGCAGGCTGTGCAAGCATGG + Intronic
920900503 1:210105962-210105984 TTCTGCAGGCTGTACAAGCATGG - Intronic
920972519 1:210754724-210754746 TTCTGCAGGCCATACAAGCATGG - Intronic
921040065 1:211422531-211422553 TTCTGCAGGCTGCACAAGAATGG + Intergenic
921128202 1:212196563-212196585 TTCTGCAGGTTGTACAGTCATGG - Intergenic
921210980 1:212897591-212897613 TTCTGCAGGCTGTGTAAGCATGG + Exonic
921306541 1:213802873-213802895 TTCTCCAGGCTAAACATTCCCGG - Intergenic
921472005 1:215560884-215560906 TTCTGCAGGCTGTACAAGTATGG - Intergenic
921533897 1:216320328-216320350 TACTGCAGGCTATACAAGCTTGG - Intronic
921730969 1:218577467-218577489 TTCTGCAGGCTGTACAAGCATGG - Intergenic
921897411 1:220414736-220414758 TTCTGCAGGCTGTACAAGCATGG - Intergenic
922183059 1:223251211-223251233 TTCTGCAGGCTGTACCAGCATGG + Intronic
922212925 1:223499301-223499323 TTCTGCAGGCTGCACAGGCATGG - Intergenic
922277535 1:224092938-224092960 TTCTGCAGGCTGTACAAGCATGG - Intergenic
922335208 1:224613808-224613830 TTCTGCAGGCTGTACAAGCACGG - Intronic
922352064 1:224742504-224742526 TTCTGCAGGCTGTACGAGCATGG + Intergenic
922741506 1:228016711-228016733 TTCTGCAGGCTGTACAAGCATGG + Intronic
922862962 1:228835111-228835133 TTCTGCAGGCTGTACAAGCATGG + Intergenic
922977982 1:229801019-229801041 CTCTGCAGGCTGCACAAGCATGG - Intergenic
922999567 1:229995551-229995573 TTCTGCAAGCTGTACAAACATGG - Intergenic
922999583 1:229995786-229995808 TTCTGCAGGCTGTACAAGCATGG - Intergenic
923027780 1:230219623-230219645 TACTGCAGGCCATCTATGCAGGG - Intronic
923238868 1:232061250-232061272 TTCTGCAGGCTGTACTAGCATGG - Intergenic
923628745 1:235635605-235635627 TTCTGCAGGTTGTACAAGCATGG - Intronic
923817244 1:237394858-237394880 TTCTGCAGGCTCTATAGGCTGGG + Intronic
923949074 1:238926690-238926712 TTCTGCAGGTTGTACAAGCATGG + Intergenic
923994986 1:239484167-239484189 TTCTGCAGGCTGTACAAGCATGG + Intronic
924192069 1:241564189-241564211 CTCTGTAAGCTATACATGGAAGG + Intronic
924287529 1:242503418-242503440 TTCTGCAAGCTGTACAAACATGG - Intronic
924455448 1:244215440-244215462 TTCTGCAGGCTGTGCAAGCATGG + Intergenic
924455568 1:244216497-244216519 TTCTGCAGGCTGCGCAAGCATGG + Intergenic
924504858 1:244672437-244672459 TTCTGCAGGCTGTACAAGCATGG - Intronic
924767257 1:247045563-247045585 TTCTGCAGGCTGTACAAGCATGG - Intronic
1062770414 10:95989-96011 TTCTGCAGGCTGTACAAGCATGG + Intergenic
1063094544 10:2898314-2898336 TTCTGCAGGCTGTACAAGCATGG + Intergenic
1063550112 10:7024237-7024259 TTGTGTAGGCTGTACAAGCATGG - Intergenic
1063591358 10:7398912-7398934 TTCTGTAAGCCAGACATGCATGG + Intronic
1063710453 10:8472366-8472388 TTCTGCAGGATGTACCAGCACGG + Intergenic
1063814916 10:9760480-9760502 TTCTGCAAGCTGTACAATCAAGG + Intergenic
1064184225 10:13146858-13146880 TTCTGCAGACTGTAGAAGCATGG + Intergenic
1064292970 10:14052413-14052435 TTTTGCAGGCTGTACAAGCATGG + Intronic
1064359884 10:14655022-14655044 TTCTGCAGGCTGTACAAGCATGG + Intronic
1064402794 10:15035362-15035384 TTCTGCAGTCTATACAGAAAGGG + Intronic
1064421440 10:15194285-15194307 TTCTGCAGGCTGTATAGGCATGG + Intergenic
1064834732 10:19513383-19513405 TTCTGCAAGCTGTATAAGCATGG - Intronic
1065002363 10:21348495-21348517 TTCTGCAGGATGTACAAGCATGG + Intergenic
1065078614 10:22105460-22105482 TTCTGCAGACTGTACAAGCATGG - Intergenic
1065281991 10:24148707-24148729 TTCTGCAAGCTGTACAAGCATGG - Intronic
1065448137 10:25824069-25824091 TTCTGCAGGCTGTACAGGCATGG + Intergenic
1065692148 10:28345493-28345515 TTCTGCAGGCTGTGCAGGCACGG - Intergenic
1065904029 10:30232633-30232655 TTCTGCAGGCTATATAAGCATGG - Intergenic
1066066452 10:31764746-31764768 TTCTGCAGACTGTACAAGCATGG - Intergenic
1066201714 10:33148046-33148068 TTCTGCAGGCTGTATAAGCATGG - Intergenic
1066498867 10:35970835-35970857 TTCTGCAGGCCTTACAAGGATGG - Intergenic
1066706008 10:38178801-38178823 ATCTTCAGGCTGTACAAGCATGG + Intergenic
1066984293 10:42450763-42450785 ATCTTCAGGCTGTACAAGCATGG - Intergenic
1067137790 10:43626538-43626560 TTCCGCAGGCTGTACAAGCATGG - Intergenic
1067814372 10:49461320-49461342 TGCTGCATGCCATACTTGCAAGG - Intronic
1068047109 10:51900054-51900076 TTCTGCAGGCTGTAAAAGCATGG - Intronic
1068148333 10:53099547-53099569 TTCTGCAGGCTGTACAAGCATGG + Intergenic
1069130768 10:64699352-64699374 TTCTGCAGGCTGTACAAGCATGG + Intergenic
1069650537 10:70043897-70043919 TTCTGCAGGCTGTGCAAGCATGG - Intergenic
1069742351 10:70692971-70692993 TTCTGCAGGCTGTACCAGCATGG + Intronic
1070245625 10:74728893-74728915 TTCTGTAGGCTGTACAAACATGG - Intergenic
1070246025 10:74731740-74731762 TTCTGCAGGCTGTCCAAGCATGG - Intergenic
1070522095 10:77262802-77262824 TTCTGCAGGCTGTACAAGCATGG - Intronic
1071119610 10:82262078-82262100 TTCTGCAGGCTTTCCAATCATGG - Intronic
1071147112 10:82588463-82588485 TTCTGCAGGCTGTACAACCATGG - Intronic
1071203784 10:83251527-83251549 CTCTGCAAGCTGTACAAGCATGG + Intergenic
1071242823 10:83727279-83727301 TTCTGTGGGCTGTACAAGCATGG - Intergenic
1071277459 10:84068737-84068759 TTCTACAGGCTGTGCAAGCATGG - Intergenic
1071391573 10:85180479-85180501 TTCTGCAGGCTGTACAGGAAAGG - Intergenic
1071664504 10:87541637-87541659 TTCTGCAGGTTGTAAAAGCATGG + Intronic
1071757125 10:88555592-88555614 TTCTGCGGGCTATACAAGCATGG - Intronic
1071923408 10:90377153-90377175 TTCTGCAGGCCATACATTCATGG + Intergenic
1072233066 10:93429315-93429337 TTCTGCAGGCTGTACAAGCATGG - Intronic
1072491497 10:95910338-95910360 TTCTGCAGGCTATATAAGCATGG + Intronic
1073688912 10:105786008-105786030 TTCTGCAGGCTGCACAAGCATGG + Intergenic
1073729562 10:106272273-106272295 TTCTGCAGACTATGCATACCTGG + Intergenic
1073916016 10:108404236-108404258 TTCTGCAGGCTTTTCTTCCAAGG + Intergenic
1074100233 10:110348904-110348926 TTCTGCAGGCTACACAAGTATGG + Intergenic
1074260166 10:111845687-111845709 TTCTGCAGGCTGTGCAAGCATGG + Intergenic
1074440285 10:113471910-113471932 TTCTGCAGGCTCTACAAGCATGG + Intergenic
1074709769 10:116167510-116167532 TTCTGCAGACATTACATGCCAGG - Intronic
1074927293 10:118086172-118086194 TTCTGCAGGCTATACAAGCATGG + Intergenic
1075166402 10:120071825-120071847 TTTTGCAGGCTGTATAAGCATGG + Intergenic
1075378048 10:121995614-121995636 TTCTGAAGGCTGTACAGGCTTGG + Intronic
1075576169 10:123579108-123579130 TTCTGCAGGCTGTGCAAGCATGG - Intergenic
1075753857 10:124794943-124794965 TTCTACACTCTGTACATGCACGG - Intergenic
1076046079 10:127295172-127295194 TTCTGCAGGCTGTACAAGCGTGG + Intronic
1076287300 10:129312762-129312784 TTCTGCAGGCTGTACAAGCATGG + Intergenic
1076419716 10:130322405-130322427 TTTTGCAGGCTGTACTAGCATGG + Intergenic
1076465666 10:130679855-130679877 TTCTGCAGGCTATAGAAGCATGG - Intergenic
1076561248 10:131366205-131366227 TTCTGCAGTCTGTACAAGCATGG + Intergenic
1077258185 11:1598815-1598837 TTCTGCAGGCTGCACAAGCATGG + Intergenic
1077736951 11:4801354-4801376 TTTTGCAGGCTGCACAAGCATGG + Intronic
1077744855 11:4891222-4891244 TTCTGCAGGCTCTTCTAGCATGG + Intronic
1077797834 11:5509694-5509716 ATCTGCAGGGTCTACATGAAAGG + Intronic
1077941695 11:6849647-6849669 TTCTGCAGGCTGTACAAGCATGG - Intergenic
1078087975 11:8245842-8245864 TTCTGTAGGTTGTACAAGCATGG + Intronic
1078512015 11:11991718-11991740 TTCTGCGGGCTGTACGAGCATGG - Intronic
1078512131 11:11992780-11992802 TTCTGCAGGCTATACGAGCATGG - Intronic
1078905622 11:15685661-15685683 TTCTACAGGCTATACAAGCATGG + Intergenic
1079208391 11:18438121-18438143 TTCTGCAGGTTGTACAGGCATGG + Intronic
1079254145 11:18812042-18812064 TTCTGCAGGCTGTATAAGCATGG + Intergenic
1079349764 11:19682586-19682608 TTCTGAAGGCTATACAAGCATGG + Intronic
1080044480 11:27794872-27794894 TTCTGCAGGCTATACAAGGATGG + Intergenic
1080109931 11:28555225-28555247 TTCTGCAGGCTGTACAAGCATGG - Intergenic
1080255964 11:30290898-30290920 TTCTGCAGGCTGTACAAGCATGG + Intergenic
1080338409 11:31227219-31227241 TTCTGTAGACTGTACAAGCATGG + Intronic
1080474232 11:32574861-32574883 CTCTGCAGGCTGTACAGGCATGG + Intergenic
1080547236 11:33332848-33332870 TTCTGCAGGCTGTACAAGCAGGG + Intronic
1080562164 11:33473927-33473949 TTCTGCGGGCTGTACAAGCATGG + Intergenic
1080831014 11:35893285-35893307 TTCTGCAGGCTATACAAGCATGG - Intergenic
1080878755 11:36300209-36300231 TTCTGCAGGCTGTACAAGCATGG + Intronic
1081005581 11:37733108-37733130 TTCTGCAGCCTGTACAATCATGG - Intergenic
1081243176 11:40731474-40731496 TTCTGTAGGCTGTACAAGCATGG - Intronic
1081286408 11:41275184-41275206 TTCTGTAGGCTTCACAGGCATGG - Intronic
1081404711 11:42683593-42683615 TTCTGCAGGCTGTACAAGCATGG - Intergenic
1081529283 11:43947054-43947076 TTCTGCAGGCTATACAAGCATGG + Intergenic
1081650556 11:44820952-44820974 TTCTACAGGCTGTACAAGCATGG - Intronic
1081682539 11:45018326-45018348 TTCTGCAGGCTGTACAAACATGG + Intergenic
1081788223 11:45763540-45763562 TTCTGCAGGCTGTACAAGCATGG - Intergenic
1082127978 11:48454975-48454997 TTCTTCAGGCTGAACAAGCATGG + Intergenic
1082249435 11:49962437-49962459 TTCTTCAGGCTGAACAAGCATGG - Intergenic
1082696769 11:56376482-56376504 TTCTGGAGGCTATAGATTAAGGG - Exonic
1082862192 11:57867422-57867444 TTCTGCAGGCTGTGCAAGCATGG + Intergenic
1082930016 11:58592841-58592863 TTCTGCAGGCTGTACAAGCATGG + Intronic
1082949096 11:58791158-58791180 TTCTACAGGCAGTACAAGCATGG + Intergenic
1083964926 11:66037590-66037612 TTCTGCAGGCTGTACAGGCATGG - Intergenic
1084309034 11:68305366-68305388 TTCTGCAGGCTGTACAAGCATGG - Intergenic
1084798675 11:71526733-71526755 TTCTGCAGGCTGCACAAGCATGG - Intergenic
1084803772 11:71564995-71565017 TTCTGCAGGCTGCACAAGCATGG - Intronic
1084963594 11:72731543-72731565 CTCTGCAGGCTGTATAAGCATGG - Intronic
1085057924 11:73418456-73418478 TTCTGCAGGCTGCACAAGCATGG - Intronic
1085134208 11:74070545-74070567 TTCTGAAGCCTAAACAAGCAAGG - Intronic
1085193829 11:74653870-74653892 TTCTGCAGGCTGTACAAGCATGG + Intronic
1085362417 11:75902360-75902382 TACTGTAAACTATACATGCAAGG - Intronic
1085383971 11:76145578-76145600 TTCTGCAGGCTATATAAGCATGG - Intergenic
1085670014 11:78454552-78454574 TTCTGCAGACTGTACAAGAATGG - Intronic
1085690999 11:78663631-78663653 TTCTGCAGGCTCTATAAGCATGG - Intronic
1085812185 11:79694133-79694155 TTCTGCAGGGTGTACAGGAATGG + Intergenic
1085975786 11:81652609-81652631 TTCTGCATGCCATACAGGCAAGG - Intergenic
1085986537 11:81794172-81794194 TTCTGTAGGCTGTAAAAGCATGG - Intergenic
1085989190 11:81820484-81820506 TTCTGCAGGCTCTGCAAGCATGG + Intergenic
1086005884 11:82035220-82035242 TTCTGTAAGCTATACAAGAATGG + Intergenic
1086024236 11:82270683-82270705 TTCTGCAGAGTGTACAAGCATGG - Intergenic
1086238309 11:84658793-84658815 TTCAGCAGGCTGTACAAACATGG - Intronic
1086385009 11:86298188-86298210 TTCTGCAGGCTGTACCAGCATGG + Intergenic
1086391519 11:86369990-86370012 TTCTGCAGGCTGTACAAGCATGG - Intergenic
1086553927 11:88087390-88087412 TTCTGCAGGCTTTACAGGCATGG + Intergenic
1086729150 11:90227023-90227045 TTCTGCAGGCTATACAGGAAGGG + Intergenic
1086871445 11:92042132-92042154 TTCTGCAGGCTCTACTAGCATGG - Intergenic
1087136756 11:94728938-94728960 ATCTGAAAGCTATACATACAAGG + Intronic
1087301212 11:96438795-96438817 TTCTGCAGGCTGTATAAGCATGG + Intronic
1087699255 11:101417280-101417302 TTCTGCAGGCTGTATAAGCATGG + Intergenic
1088109494 11:106245900-106245922 TTCTTCAGGCTGTACAAGCATGG - Intergenic
1088135230 11:106548728-106548750 TTCTGCAGGCTGTACTAACATGG - Intergenic
1088136521 11:106562200-106562222 TTCTGCAGACTGTACAAGCATGG - Intergenic
1088141884 11:106626941-106626963 TTATACAGGCTTTACATCCAAGG + Intergenic
1088421149 11:109648418-109648440 TTCTTCAGGCTGTACAAGCATGG - Intergenic
1088453915 11:110013876-110013898 CTCTGCAGGCTGTACAAGCATGG + Intergenic
1088454060 11:110015102-110015124 TTCTGCAAGCTGTACAAGCATGG + Intergenic
1088528923 11:110786833-110786855 TTCTGCAGGCAGTACAACCATGG - Intergenic
1088546601 11:110965784-110965806 TTCTGCAGGCTGTAAAAGCATGG + Intergenic
1088554396 11:111047361-111047383 TTCTGCAGGCTGAACAAACAAGG + Intergenic
1088923372 11:114278114-114278136 TTCTGCAGGCTGTACAAGCATGG + Intronic
1088951783 11:114579068-114579090 TCTTGCAGGCTGTACAAGCATGG + Intronic
1089187386 11:116628598-116628620 TTCTGCAGGCTGTATAAGCATGG + Intergenic
1089575752 11:119441869-119441891 TTCTGCAGGCTGTACAAGCATGG + Intergenic
1089584838 11:119503676-119503698 TTCTGCAGGCTGTACAAGCATGG - Intergenic
1089820862 11:121225154-121225176 TTCCGCAGGCTGTGCAAGCATGG + Intergenic
1089821205 11:121227836-121227858 TTCTGCAGGTTGTACAAGCATGG + Intergenic
1089901812 11:121994187-121994209 TCCTGCAGGCTGTACAAGCATGG - Intergenic
1089929912 11:122299591-122299613 TTCTGCAGGCTATACAAACACGG + Intergenic
1090257955 11:125299007-125299029 TTCTGCAGGCTGTACAAGCATGG + Intronic
1090338984 11:125998534-125998556 TTCTAAAGGCTATGCAGGCATGG - Intronic
1090521356 11:127482995-127483017 TTCTGCAGGCTATACAAGGATGG + Intergenic
1090860306 11:130647215-130647237 TTCTGCAGGCTGTACAAGCATGG + Intergenic
1090994055 11:131849326-131849348 TTCTGCAGGCTGTCTAAGCATGG + Intronic
1091211701 11:133866112-133866134 TTCTGTAGGCTGTACAAGCATGG + Intergenic
1091852590 12:3712352-3712374 TTCTGCAAGCTATGCAAGCATGG + Intronic
1091960849 12:4692894-4692916 TTCTGTAGGCTGTACAAGCATGG + Exonic
1091989803 12:4946277-4946299 TTCTGCAGGCTATACAAGCATGG + Intergenic
1092080425 12:5711437-5711459 TTCTGCAGGCTGTACAAGCATGG - Intronic
1092168683 12:6359688-6359710 TTCTGCAGATTGTACAAGCATGG - Intronic
1092273971 12:7045302-7045324 CTCTACAGGCTGTACAGGCATGG + Intronic
1092668936 12:10840202-10840224 TTCTGCAGGGTGTACAGGCATGG + Intronic
1092701255 12:11233592-11233614 TTCTGCAGGCTGTACAAGCATGG + Intergenic
1093070690 12:14705097-14705119 TTCTGCAGGCTGTACGAGCATGG + Intergenic
1093536912 12:20232989-20233011 TTCTGCAGGCTGTACAAGAGTGG + Intergenic
1093613709 12:21194817-21194839 TTCTGCAAGCTGTACAGGCATGG + Intronic
1093698383 12:22189276-22189298 TTCTGCAAACTGTACAAGCAGGG - Intronic
1093730420 12:22559909-22559931 TTCTGCAGGCTGTACAAGCATGG - Intergenic
1093771206 12:23020756-23020778 TTATGCAGGCTGTATAAGCATGG + Intergenic
1093872250 12:24306520-24306542 TTCTTCAGGCTTTGCTTGCAGGG + Intergenic
1093906863 12:24703265-24703287 TTCTGCAGGCTACATAGCCATGG - Intergenic
1094068142 12:26383245-26383267 TTCTGCAGGCTGTACAAACATGG - Intronic
1094084458 12:26574681-26574703 TTCTGCGGGCCATACAAGCATGG + Intronic
1094144091 12:27210820-27210842 TTCTGTAGGCTGTACAAGCGTGG - Intergenic
1094169955 12:27480821-27480843 TTCTGTAAGCTGTACAGGCATGG - Intronic
1094394944 12:29995526-29995548 TTCTGCAGACTGTAGAAGCATGG - Intergenic
1094408109 12:30140256-30140278 TTCTGCAAGCTGTACAAGCATGG - Intergenic
1094425275 12:30310435-30310457 TTCTGCAGGCCCTACTTCCAGGG + Intergenic
1094428051 12:30336558-30336580 TTCTGCAGGCTGTACAAGCATGG + Intergenic
1094445495 12:30525300-30525322 TTCTGGAGGCCAGACATCCAAGG + Intergenic
1094736220 12:33237277-33237299 TTCTACAGGGTGTACAGGCATGG - Intergenic
1094822242 12:34235162-34235184 TTCTTCAGGCAAAACATGCCAGG + Intergenic
1095092453 12:38119933-38119955 TTCTTCAGGCAAAACATGCCAGG - Intergenic
1095143692 12:38697915-38697937 TTCTGCAGGCTGTATAAGCATGG - Intronic
1095175589 12:39088675-39088697 TTCTGTAGGCCATGCAAGCATGG + Intergenic
1095520487 12:43058526-43058548 TTCTGCAGGCTGTACAAACATGG - Intergenic
1095580322 12:43789379-43789401 TTCTGCAGGCCATACTAGCACGG - Intronic
1095699257 12:45174530-45174552 TTCTGTAGATAATACATGCATGG - Intergenic
1095730178 12:45498122-45498144 TTCTGCAGGCTGCACAAGCATGG + Intergenic
1096518063 12:52169033-52169055 TTCTGCAGGCTGTACTGGCATGG + Exonic
1097356690 12:58610246-58610268 TTCTGCATGCTGACCATGCATGG - Intronic
1097512216 12:60558146-60558168 TTCTGAAGGCATTACCTGCAAGG + Intergenic
1097870305 12:64596446-64596468 TTCTGCAGGCTGTACAAGCATGG + Intergenic
1098055661 12:66502761-66502783 TTCTGCAGGCTGTACAAGCATGG - Intronic
1098100182 12:67006845-67006867 TTCTACAGCAAATACATGCATGG + Intergenic
1098287274 12:68920186-68920208 TTCTGCAGGCTGCACAAGCGTGG - Intronic
1098325490 12:69297875-69297897 TTGTGCAGGCCATACAAGCATGG - Intergenic
1098337722 12:69420869-69420891 TTCTGGATGCTGTACATGGATGG + Intergenic
1098470031 12:70832780-70832802 TTCTGCAGGCTGTACAAGCATGG + Intronic
1098608087 12:72419403-72419425 TTCTGCAAGCTGTACAAGTATGG + Intronic
1098655240 12:73019817-73019839 TTCTGCAAGCTGTACAAGCATGG - Intergenic
1099196113 12:79617993-79618015 TTCTACAGGCTACACAAGCATGG - Intronic
1099544184 12:83955891-83955913 CTCTGCAGGCTATACAAGCATGG + Intergenic
1099871218 12:88351746-88351768 TTCTGCAAGCTGTACAAGCATGG + Intergenic
1099990220 12:89713635-89713657 TTCTGCAGCGTGTACAAGCATGG + Intergenic
1100002534 12:89854941-89854963 TTCTGCAGGCTGTACAAGCATGG + Intergenic
1100052278 12:90462760-90462782 TTCTGCAGGCTGCACAAGCAAGG + Intergenic
1100095276 12:91026557-91026579 TTCTGCAGGCTGTACAATCATGG + Intergenic
1100208444 12:92376429-92376451 TTCTTCAGGCTGTACAAGCATGG - Intergenic
1100465010 12:94836715-94836737 TTCTGCAGGCTGTACATGCATGG + Intergenic
1100692567 12:97054127-97054149 TTCTGCAGGCTGTACAAGCATGG + Intergenic
1100915951 12:99422042-99422064 TTCTGCAGGCTGTGCAAGCATGG - Intronic
1100919167 12:99462970-99462992 TTCTGCAGGATGTTCAAGCATGG - Intronic
1101353369 12:103954347-103954369 TTCTGCAGGCTGTACAAGCATGG + Intronic
1101419992 12:104543043-104543065 TTCTGCAGGCTGTACAAGCATGG + Intronic
1101510816 12:105390831-105390853 TTCTGCAGGCTCTACTAGGATGG + Intronic
1101636061 12:106542410-106542432 TTCTGCAGGCTCTACAAGCATGG + Intronic
1101637957 12:106561850-106561872 TTCTACAGGTTGTACAGGCATGG - Intronic
1101918329 12:108912984-108913006 TTCTGCAGGCTGTACAAGCATGG - Intronic
1102381067 12:112467349-112467371 TTCTGAAGGCTGTACAAGCATGG + Intronic
1102485357 12:113251780-113251802 TTCTGCAGGCAAGCCATGGAAGG + Intronic
1102725834 12:115063804-115063826 ATCTGCAGGCTGTACAAGCATGG - Intergenic
1103024294 12:117560930-117560952 TTCTGCAGGCTGTACAAGTATGG - Intronic
1103265558 12:119627422-119627444 TTCTGCAGGCTAAACAAACATGG + Intronic
1104118232 12:125771460-125771482 TTCTGCAGGCTGTACAAGCATGG + Intergenic
1104183317 12:126403876-126403898 TTCTTCAGGCTGTACAAGCACGG + Intergenic
1104370675 12:128221387-128221409 TTCTGCAGGCTGCACAAGCATGG + Intergenic
1104542213 12:129676473-129676495 TTCTGCAGGCTGTGCAGACATGG + Intronic
1104577461 12:129980734-129980756 TTCTGGAGGCTGGACATCCAAGG - Intergenic
1104644564 12:130487542-130487564 TTCTGCAGGCTGTACAAGCATGG - Intronic
1105318242 13:19288874-19288896 TACTGCAGGCTGTACACACATGG - Intergenic
1105734493 13:23253965-23253987 TTCTGCAGGCTGTACAAACATGG - Intronic
1106301321 13:28468805-28468827 TTCTCCAGGCTGTACAAGCATGG - Intronic
1106399617 13:29417072-29417094 TTCTGCAGGTTGTGCAAGCATGG + Intronic
1106811435 13:33362140-33362162 TTCTGCAGGCTGTACAAGCGAGG + Intergenic
1107021116 13:35752709-35752731 TTCTGCAGGCTGTACAAGCATGG + Intergenic
1107194104 13:37626828-37626850 TTCTGCAGGCTGCGCAAGCATGG - Intergenic
1107417800 13:40217466-40217488 TTTTGTAGGCTGTACAAGCATGG - Intergenic
1107799255 13:44088684-44088706 TTCTGCAGGCTGTGCAAGCATGG - Intergenic
1107816243 13:44247010-44247032 TTCTGCAGGCTGTACAAGCATGG - Intergenic
1108009947 13:45995762-45995784 TTCTGCAGGCCGTACAAACATGG - Intronic
1108069624 13:46615195-46615217 TTCTGCAGGCTCTGCAAGCATGG + Intronic
1109336917 13:61005836-61005858 CTCAGCAGGCTCTACAGGCATGG - Intergenic
1109711174 13:66162565-66162587 TTCTGCAGGCTGTACAAGCATGG - Intergenic
1109771649 13:66982234-66982256 CACTGCAGGCTGTACAAGCATGG - Intronic
1109828961 13:67761000-67761022 TTCTGCAGGTTGTACAAGCATGG + Intergenic
1109889393 13:68588766-68588788 TTCTGCAGGCTGTACAAGCATGG + Intergenic
1110241870 13:73276763-73276785 TTCTGCAGGCTATACAAACATGG - Intergenic
1110515507 13:76407901-76407923 TTTTGCAGGCTGTATAAGCATGG + Intergenic
1110518485 13:76445357-76445379 TTCTGCAGGCTATAGACATAAGG - Intergenic
1110723898 13:78796985-78797007 TTCTGCAGGCTGTATAAGCATGG - Intergenic
1110797520 13:79657438-79657460 TTCTACAGGCTATACAAGCATGG - Intergenic
1111283906 13:86063750-86063772 TTCCGCAGGCTATACAAGCATGG + Intergenic
1111643662 13:91002703-91002725 TTATGCAGGCTGTACAAGCATGG - Intergenic
1111807822 13:93059703-93059725 TTCTGCAGGCTGTACAAGCAAGG - Intergenic
1111813335 13:93119623-93119645 TTCTACAGGCTGTACAAGCATGG + Intergenic
1111937395 13:94571124-94571146 TTCTGCAGGCTGTACAATCATGG + Intergenic
1111968090 13:94881343-94881365 TTCTACAGGCTGTACAAGCATGG + Intergenic
1112084677 13:96017470-96017492 TTCTGCAGTCTGTACAAACATGG - Intronic
1112093752 13:96110119-96110141 TTCTGCTGGCTATATAAGCATGG + Intronic
1112179345 13:97062272-97062294 TTCTGCAGGCTGTATAAGCACGG + Intergenic
1112182917 13:97103083-97103105 TTCTGCAGGCTGTACAAGCATGG + Intergenic
1112314840 13:98351664-98351686 TTCTGTAGGCTCTATAAGCATGG + Intronic
1112356378 13:98677459-98677481 TTCAGCAGGCTGTACAGGCATGG - Intergenic
1112437777 13:99403958-99403980 TTCTGCAGGCTGTACAAGCATGG + Intergenic
1112450869 13:99508596-99508618 TTCTGCAGGCTGTACAAGCATGG + Intronic
1112656829 13:101460679-101460701 TTTTGCAGGCTGTACAAGCAAGG + Intronic
1112675651 13:101698625-101698647 TTATGCAACCTATGCATGCATGG + Intronic
1112716256 13:102189731-102189753 TTCTGCAGGTTATGCAAGCATGG + Intronic
1112860133 13:103820022-103820044 TTCTGAAGGCTGTACAAGAATGG + Intergenic
1112999044 13:105610842-105610864 TTCTGCAGACTGTACAAGCATGG + Intergenic
1113012424 13:105784935-105784957 TTCTGCAGGCTATACAAGAAGGG - Intergenic
1113282852 13:108809418-108809440 GTCTGCAGACTGTACAAGCATGG + Intronic
1113295947 13:108958960-108958982 TTCTGAAGCCAATACATGGATGG + Intronic
1113615236 13:111675865-111675887 TTCTGCAGGCTGTATAAGCATGG + Intergenic
1113620703 13:111760778-111760800 TTCTGCAGGCTGTATAAGCATGG + Intergenic
1113825149 13:113246983-113247005 TTCTGCAGGCTATACAAGCATGG + Intronic
1114081981 14:19209155-19209177 AGCTGCAGGCTGTACAAGCATGG - Intergenic
1114590647 14:23861622-23861644 TTCTGCAGGCTGTACAAGCATGG + Intergenic
1114789111 14:25635928-25635950 TTCTGCAGGCTATACAAGCACGG - Intergenic
1115116177 14:29883012-29883034 TTCTGCAGGCTATACAAGCATGG + Intronic
1115150299 14:30276767-30276789 TTCTGCAGGATGTACAAGCATGG - Intergenic
1115715289 14:36096970-36096992 TTTTGCAGGCTGTACAAGCATGG + Intergenic
1115874657 14:37846737-37846759 TTCTGCAGGCTTTACAAGCAGGG - Intronic
1115929165 14:38471513-38471535 TTCTGCAGGCTGTACAAGCATGG + Intergenic
1116290289 14:43026494-43026516 TTTTGCAGGCTGTGCAAGCATGG - Intergenic
1116340810 14:43721636-43721658 TTCTGTATGCTGTACAAGCATGG + Intergenic
1116352863 14:43887576-43887598 TTCTGCAGGCTGTACAAGCATGG - Intergenic
1116475574 14:45335075-45335097 TTCTGCAGGCTGTACAGGCATGG + Intergenic
1116510364 14:45737805-45737827 TTCTACAGGCTGTACAGGCATGG + Intergenic
1116521124 14:45848367-45848389 TTCTGTAGGCTATACAAGCATGG + Intergenic
1116536411 14:46036481-46036503 TTCTGCAGTCTGTACAATCATGG - Intergenic
1116589085 14:46748056-46748078 TTCTACAGGCTGTACAAGCATGG - Intergenic
1117281229 14:54242990-54243012 TTCTGGAGGCTGTACAAGCATGG + Intergenic
1117286768 14:54293106-54293128 TCCTCCAGGCTATAAATGTAAGG - Intergenic
1117503144 14:56374308-56374330 TTCTGCAGGCCCTACTTCCATGG - Intergenic
1117778672 14:59208984-59209006 TTCTGCAGGCTGTACATGGATGG - Intronic
1119060371 14:71468351-71468373 TTCTGCATGCTGTACAAGCATGG + Intronic
1119282589 14:73422558-73422580 TTCTGCAGGATATACAAGCATGG + Intronic
1120000903 14:79302334-79302356 TTTTGCAGACTGTACAAGCATGG + Intronic
1120227616 14:81808826-81808848 TTCTGTAGGCTGTACAGGCATGG - Intergenic
1120397859 14:83991278-83991300 TTCTGAAGGCTGTACAAGCATGG + Intergenic
1120466426 14:84863558-84863580 TTCTGCAGGCTTTACAAGCATGG - Intergenic
1120514707 14:85456980-85457002 TTCTGCAGGCTGTGCAAGCATGG - Intergenic
1120515620 14:85466032-85466054 TTCTGGAGGCTATACAAGCATGG - Intergenic
1120540081 14:85740632-85740654 TTCTGCAGGCCGCACAAGCATGG + Intergenic
1120802320 14:88704371-88704393 TTCTGCAGGCTGTACAAGCAGGG - Intronic
1120824399 14:88942446-88942468 TTATGCAGGCTCTGCCTGCAGGG + Intergenic
1121139112 14:91525367-91525389 CTCTGCAGGCTGTACAAGCATGG + Intergenic
1121161985 14:91751975-91751997 TTTTGCAGACTGTACAAGCATGG + Intronic
1121303975 14:92893861-92893883 TTCTGCAGACTGTACAAGCATGG - Intergenic
1121462874 14:94095525-94095547 TTCTGTAGGTTATACAAGCATGG + Intronic
1121513197 14:94529278-94529300 TTCTGAAGGCTGTACAAGCATGG + Intergenic
1121596630 14:95168322-95168344 ATCTGGAGGCTATACAAGCATGG - Intergenic
1121860530 14:97313548-97313570 TTCTGTAGGCTGTACAAGCATGG - Intergenic
1121890723 14:97588049-97588071 TTCTACAGGCTATATAAGCATGG + Intergenic
1121890933 14:97589883-97589905 GTCTACAGGCTGTACAAGCATGG + Intergenic
1122358923 14:101145678-101145700 TTCTGAAGACTATACTTTCAGGG - Intergenic
1122414899 14:101544732-101544754 TTCTGCAGGCTGTACAAGCCTGG + Intergenic
1123820191 15:24021758-24021780 TTCTGGAAGCTGTAGATGCAGGG + Intergenic
1123962615 15:25421320-25421342 TGCTGCAGGCTGTACAAGCATGG - Intronic
1123973694 15:25532488-25532510 TTCTGCAGGGGATAGAGGCAAGG - Intergenic
1124135502 15:27032456-27032478 TTCTGCTGGCTGTACAAGCGTGG + Intronic
1124203658 15:27699196-27699218 TTCTGCAGGCTGTACAAGCATGG - Intergenic
1125216676 15:37283291-37283313 TTCTGCAGGCTCCACTTCCACGG - Intergenic
1125406337 15:39355792-39355814 TTCTGTAGGCTGTACAAGCATGG - Intergenic
1125544767 15:40495057-40495079 TTCTGCAGGCTCTACAAGCGTGG + Intergenic
1126349876 15:47733720-47733742 TTCAGGAGGACATACATGCAAGG + Intronic
1126383750 15:48073562-48073584 TTCTGCAGGCTGTACAAGCATGG + Intergenic
1127008519 15:54596889-54596911 TTCTGCAGGCTATACAAGCATGG - Intronic
1127271045 15:57402367-57402389 TTCTGCAGGCTGTGCAAGCATGG - Intronic
1127290982 15:57570832-57570854 TTCTGTAGGCTGTACAAGCATGG - Intergenic
1127375938 15:58384289-58384311 TTCTGCAGGCTGTACAAGAATGG - Intronic
1127507136 15:59608466-59608488 TTCTGCAGGTTGTACAAGGATGG + Intronic
1127692840 15:61414732-61414754 TTCTGCAGGCTGTACAAGCATGG + Intergenic
1128427324 15:67555174-67555196 TTCTACAGGCTGTACAAGCATGG + Intronic
1128629709 15:69252291-69252313 TTCTGCAGGCTATACAAACATGG + Intronic
1129201753 15:74006714-74006736 TTCTGCATGCTGTACAATCATGG + Intronic
1129688852 15:77701817-77701839 TTCTGCAGGCCGTACAAGCATGG - Intronic
1129996956 15:80015217-80015239 TTCTGCAGGCTATAAAAGCATGG + Intergenic
1130081731 15:80739699-80739721 TTCTGCAGGCTGTACAAGCATGG - Intronic
1130141978 15:81235273-81235295 TTCTGCAAGCTATACAAGCATGG + Intronic
1130747186 15:86667916-86667938 TTCTGCAGGCTGTAAAAGCATGG + Intronic
1131352452 15:91713603-91713625 TTCTGCAGGCTGTATAAGCATGG + Intergenic
1131368928 15:91863576-91863598 TTCTTGAAGCTATACATGCGTGG + Intronic
1131491441 15:92866779-92866801 TTCTGCAGGCTGTACAATCATGG + Intergenic
1131592906 15:93768725-93768747 TTCTGCAGGCTACACAAGCAAGG + Intergenic
1131694666 15:94863688-94863710 TTCTTCAGGCTGTACAAGCATGG + Intergenic
1131705520 15:94991606-94991628 TTGTGCAGGCTGTACAAGCATGG + Intergenic
1131771769 15:95745633-95745655 TTCTGCAGGCTGTACAAGCATGG + Intergenic
1132077031 15:98830562-98830584 TTCTTCAGGCTGTTCAAGCATGG + Intronic
1132181315 15:99754847-99754869 TACAGCAGGCTATATCTGCATGG - Intergenic
1132332988 15:101025504-101025526 TTCCGCAGACTATACAAGCATGG + Intronic
1202977384 15_KI270727v1_random:310210-310232 TCCTGCAGTCAATACAAGCATGG + Intergenic
1133392264 16:5420043-5420065 TTCTGCAGGCTATATGGGCAGGG - Intergenic
1133452275 16:5913589-5913611 TTCTTCAGGCTGTACAAGCATGG - Intergenic
1133644658 16:7753283-7753305 TTCTGCGAGCTGTACAAGCATGG + Intergenic
1133677024 16:8082861-8082883 TTCTGCAGGCTGTACAAGCATGG - Intergenic
1133878065 16:9753247-9753269 TTCTGCAGGCTGTACAAGCATGG - Intergenic
1134082530 16:11335006-11335028 TTCTGCAGGCTGTACAAGCATGG + Intronic
1134647559 16:15882209-15882231 TTCTGCAGACTGTACAAGCATGG - Intronic
1134753128 16:16642264-16642286 TTGTGCAGGCTGTACAAGCATGG + Intergenic
1134794443 16:17022153-17022175 TTCTGTATGATATACATGTACGG - Intergenic
1134992929 16:18716812-18716834 TTGTGCAGGCTGTACAAGCATGG - Intergenic
1135850686 16:25960274-25960296 TTCTGCAGACTGTACAAGCATGG - Intronic
1135873157 16:26170722-26170744 TTCTGCAGGCTGTACAAGCATGG - Intergenic
1135874675 16:26187218-26187240 GTCTGCAGACTGTACAAGCATGG - Intergenic
1135923696 16:26673653-26673675 TTATGCAGACTGTACAAGCATGG - Intergenic
1135977190 16:27116260-27116282 TTCTGCAGGCTGTGCAAGCATGG + Intergenic
1136096056 16:27957776-27957798 TTCTGCAGGCTGTATAAGCATGG + Intronic
1136099419 16:27982647-27982669 CTCTGCAGGCCATATAAGCATGG + Intronic
1137501012 16:49011797-49011819 TTCTGCAGGCTATATAAGCATGG + Intergenic
1137652181 16:50130064-50130086 GGCTGCAGGCTGTACAAGCATGG + Intergenic
1137700880 16:50496879-50496901 TTCTGCAGGCTGTACAAGCATGG - Intergenic
1137936330 16:52638565-52638587 TTCTGAAGACTGTACAAGCATGG + Intergenic
1138075546 16:54038821-54038843 TTCTACAGGCTGTACAAACATGG - Intronic
1138133531 16:54501994-54502016 TTCTGCAGGCTGTACAAGAATGG + Intergenic
1138153416 16:54680402-54680424 TTCTGCAGTCTGTACAAGAACGG + Intergenic
1138320594 16:56107890-56107912 TTATGCAGGCTACAAATGCAAGG - Intergenic
1138613638 16:58147028-58147050 TTCTGCAGGCTGTACCAGCATGG - Intergenic
1138726081 16:59140794-59140816 TTTTGCAGGCTGTACAAGCATGG - Intergenic
1138795855 16:59968186-59968208 TTCTGCAGGCTGTACAAGCGTGG + Intergenic
1138996138 16:62455135-62455157 TTTTGCAGGCTGTACAAGCATGG - Intergenic
1139128116 16:64106487-64106509 TTCTGCAGGATGTACAAGTATGG - Intergenic
1139141399 16:64267221-64267243 TTCTACAAGCTATACAAGCATGG + Intergenic
1139160070 16:64494170-64494192 TTCTGCAGGCTATACAAGCATGG - Intergenic
1139183268 16:64771698-64771720 TGCAGCAGGCTGTACAAGCATGG + Intergenic
1140185323 16:72764432-72764454 TTCTGCAGGGTCTGCATTCATGG - Intergenic
1140297863 16:73726581-73726603 TTCTGAAGGCTATATAAGCACGG + Intergenic
1140826704 16:78713728-78713750 TTCTGAAGGCTGCACATTCAAGG - Intronic
1141125235 16:81396485-81396507 TTCTGCAGGCCATACAAGCATGG + Intergenic
1141248453 16:82332689-82332711 TTCTGCAGGCTGTACAAGCTTGG - Intergenic
1141763889 16:86046217-86046239 TTCTGAAGGCGAAACCTGCAGGG - Intergenic
1143991327 17:10964907-10964929 TTCTGCAGGCTATGAAAGCACGG - Intergenic
1143997890 17:11023803-11023825 TTCTGCAGGCTGTAGAAGCATGG - Intergenic
1144375972 17:14641876-14641898 TTCTGCAGGCTGTATAAGCATGG - Intergenic
1144393966 17:14825266-14825288 TTCTGCAGGCTGTACAAGCATGG - Intergenic
1144537757 17:16107513-16107535 TTCTGGAGGCTGTACGTGCAAGG - Intronic
1145290950 17:21545330-21545352 TTCTGCAGGCTGTACCAGCCTGG - Intronic
1145770251 17:27487621-27487643 TTCTGCAGGCTGTACAAGCATGG + Intronic
1146296254 17:31653042-31653064 CTCTGCAGGCTGTACAAGCATGG + Intergenic
1146538834 17:33677049-33677071 TTCTAGTGGCTATACAGGCATGG - Intronic
1146981217 17:37163370-37163392 TTCTGCAGGCTCTATAAGCATGG - Intronic
1147844175 17:43393309-43393331 GTCTGCAGGCTATCCATGTGGGG - Intergenic
1148660629 17:49328721-49328743 TTCTGCAGGCTGTACAAGCCTGG - Intronic
1149016844 17:51917521-51917543 TTCTGTAGGCTATATAAGCATGG + Intronic
1149058065 17:52388668-52388690 TGCTGCAGGCTGTACAAGTATGG - Intergenic
1149246522 17:54714728-54714750 TTCTGCAGGCTGTATAAGCATGG + Intergenic
1149281663 17:55111719-55111741 TTCTGTAGGCTATACAAACATGG - Intronic
1149469335 17:56903052-56903074 TTCTACAGGTTGTACAAGCATGG - Intronic
1149882291 17:60305192-60305214 TTCTGCAGCCTGTATAAGCATGG + Intronic
1150938113 17:69659596-69659618 TTCTGCAGGCAGTACAAGCATGG + Intergenic
1150968076 17:69994790-69994812 TTCTGCAGGCTGTACAAGCATGG - Intergenic
1150997188 17:70332285-70332307 CACTGCAGGCTGTACAAGCATGG + Intergenic
1151100116 17:71547008-71547030 TTCTGCAGGCTGTACCAGTATGG + Intergenic
1151136184 17:71947577-71947599 TTCTGCAGGCTATACAAGCATGG - Intergenic
1151183678 17:72348517-72348539 TTCTGCAGGCTGGACACCCAAGG - Intergenic
1151431189 17:74064400-74064422 TTCTGCAGGCTGTGGAAGCATGG - Intergenic
1151902239 17:77024037-77024059 TTCTGCAGGCCATAGAAGCATGG - Intergenic
1152370229 17:79883242-79883264 TTCTGAAGGCTGTACAAGCATGG + Intergenic
1153087749 18:1307856-1307878 TTCTGCAGGCTGTACAAGCTTGG + Intergenic
1153171407 18:2320044-2320066 TTCTGCAAGCTGTATAAGCATGG - Intergenic
1153232702 18:2955256-2955278 TTCTGCAGGCTGTACAAGCACGG + Intronic
1153345554 18:4021504-4021526 TTCTGGAGGCTGTACAAGCATGG - Intronic
1153615758 18:6931411-6931433 TTCTGCAAGTTGTACAAGCATGG - Intergenic
1153736756 18:8078703-8078725 TTCTGCAGACCGTACAAGCATGG + Intronic
1153744023 18:8158681-8158703 TTCTGCAGGCTTTACAAGCATGG + Intronic
1153852220 18:9106110-9106132 GTCTGCAGCATGTACATGCATGG + Intronic
1153966271 18:10185045-10185067 TTCTGCAGAATGTACAAGCATGG - Intergenic
1154058538 18:11035441-11035463 TCCTGCAGGCTGTGCAAGCACGG - Intronic
1154946502 18:21166805-21166827 TTCTGCAGGCTGTACAAGCATGG - Intergenic
1155108351 18:22689178-22689200 TTCTTCAGGCTGTATAAGCATGG + Intergenic
1155683187 18:28515012-28515034 TTCTGCAGGCTGTACAAGCATGG - Intergenic
1155688088 18:28580453-28580475 TTCTACAGGCTGTACAAGCATGG + Intergenic
1155795969 18:30036722-30036744 TTCTACAGGTTTTACAAGCATGG + Intergenic
1155808459 18:30202193-30202215 TTCTGCATGCTATAGAAGCATGG + Intergenic
1156077638 18:33300253-33300275 TTCTGCAGGCTATAGAAGCATGG - Intronic
1156111181 18:33729353-33729375 ATCTCCAGGCTGTACCTGCAGGG + Intronic
1156181928 18:34615085-34615107 TTCTACAGGCTGTGCAAGCATGG + Intronic
1156678269 18:39557615-39557637 TTCTGCAGGCTGTACAAGCATGG - Intergenic
1157049908 18:44151526-44151548 TTCTGCAGACTGTACAAGCATGG + Intergenic
1157516763 18:48316727-48316749 TTCTGCAGGCTGTGCAAGCATGG - Intronic
1157779379 18:50423874-50423896 TTCTGCAGGCTGTATCAGCATGG - Intergenic
1157783352 18:50459620-50459642 TTCTGCAGGCTATATGAGCATGG - Intergenic
1158091980 18:53725658-53725680 TTATGCAGTCAATACATGAATGG + Intergenic
1158314262 18:56193327-56193349 TTCTGCAGGCTGTACGAGTATGG - Intergenic
1158417062 18:57257753-57257775 TTCTGCAGGTTGTACAAGCATGG - Intergenic
1158898725 18:61940889-61940911 TTTTGCAGGCTGTACGAGCATGG + Intergenic
1158904584 18:61999927-61999949 TTTTGCAGGCTATATAAGCATGG + Intergenic
1158904904 18:62002322-62002344 TTTTGCAGGCTATACAAGCATGG + Intergenic
1159030862 18:63229695-63229717 TTCTGCAGGCTGTACAGTCATGG - Intronic
1159362207 18:67420019-67420041 TTCTGCAGGCTGTACAAGCATGG + Intergenic
1159542962 18:69802790-69802812 TTCTGCAGGCTGTACAAGCATGG - Intronic
1159925502 18:74265657-74265679 TTCTGCAGCCTGTACAAGCACGG + Intronic
1159960094 18:74548468-74548490 TTCTGAAGGCTGTATAAGCATGG - Intronic
1160010291 18:75102239-75102261 TTCTGCAGGCTGTATAAGCATGG + Intergenic
1160088016 18:75797513-75797535 TTCTTCAGGCTAAACATTCATGG + Intergenic
1160121610 18:76135307-76135329 TTCTGTAGGCTGTACAAGCATGG + Intergenic
1161127925 19:2570270-2570292 TTCTACAGACCATACAAGCATGG - Intronic
1162211659 19:9096682-9096704 TTCTGCAGACTGTACAAGAAGGG - Intergenic
1163056651 19:14725032-14725054 TTCTGCAGGCTCTACAAGCATGG + Intronic
1164451741 19:28372020-28372042 TTCTGCAGGCTGTACAAGCATGG - Intergenic
1164523819 19:28999143-28999165 TTCTGCAGGCTGTATAAACATGG + Intergenic
1164597281 19:29538622-29538644 TTCTGCAGGCTGTGCAAGCAAGG + Intronic
1164675977 19:30101818-30101840 TTCTGCAGGCCATACAAGCATGG + Intergenic
1164710693 19:30355119-30355141 TTCTTCCGGCTGTACAAGCATGG + Intronic
1164851323 19:31486659-31486681 TTCTGCAGGCTGTACAAGCATGG + Intergenic
1164858537 19:31544274-31544296 TTCTGCAGGCTGTACAAGCATGG + Intergenic
1164883254 19:31754459-31754481 TTCCGCAGGCTGTACAAACATGG + Intergenic
1164896457 19:31881544-31881566 TTCTGCAGGCTGTACAAGCATGG + Intergenic
1164921305 19:32090533-32090555 TTCTGCAGGCTGTACAAGCATGG - Intergenic
1165016947 19:32888261-32888283 TTCTCCAAGCCATACATGAAAGG + Intronic
1165147722 19:33742335-33742357 TTCTGCAGGCTGTACAAGCGTGG + Intronic
1165191397 19:34066716-34066738 TTCTGCAGGCTGTACAAGCATGG - Intergenic
1165269727 19:34695673-34695695 TTCTTCAGGCTGTACAAGCATGG - Intergenic
1165288985 19:34867941-34867963 TTCTGCAGGCTGTGCAAGCATGG + Intergenic
1166281858 19:41799431-41799453 ATCTGCAGGCTATACAGGCATGG - Intronic
1166651673 19:44579830-44579852 TTCTGCAGACTGTACAAGCATGG - Intergenic
1167653069 19:50743875-50743897 TTCTGCAGGCTGTACAAGCATGG - Intergenic
1167769651 19:51506853-51506875 TTCTGCAGGATGTACAAGTAAGG - Intergenic
1168095657 19:54113431-54113453 TTCTGGAGGCTAGACATCCAAGG - Intronic
1168236506 19:55067109-55067131 TGCTGCATGCAACACATGCATGG + Intronic
1168448389 19:56444218-56444240 TTCAGTAGGCTGTACAAGCATGG + Intronic
1168665335 19:58200851-58200873 TTCTGCAGGCTGTACAAGGGTGG + Intronic
1168704110 19:58458664-58458686 TTCTGCAGGATGTACAGCCATGG + Intergenic
924963075 2:51449-51471 TTCTGCATTCCATACAAGCATGG - Intergenic
925122380 2:1429322-1429344 TTCTTCTGGCTATATAAGCATGG - Intronic
925216249 2:2098081-2098103 TTCTGCAGGTTGCACAAGCATGG - Intronic
925357305 2:3250899-3250921 TTCTGCAGGCTATATAAGCATGG - Intronic
925498651 2:4480503-4480525 TTCTGCTGGCTATAAAAGCATGG + Intergenic
925559960 2:5180992-5181014 TTCTGCAGGCTATACAGGCACGG + Intergenic
925758341 2:7156888-7156910 TTCTGCAGGCTGTACAAGCATGG - Intergenic
925889735 2:8424013-8424035 TTCTGCAGGCTGTACAAGCATGG + Intergenic
925907825 2:8549864-8549886 TTCTGCTGGCTGTACAAGCATGG - Intergenic
926563472 2:14444029-14444051 TTCTACAGGCTGTACAAGCATGG + Intergenic
926630506 2:15131755-15131777 TTCTGCAGGATGTACAAGCATGG + Intergenic
926842221 2:17093347-17093369 CTCTGCAGGCTGTACAAACATGG - Intergenic
926849142 2:17175520-17175542 TTCTGCAGGCTGTATAAGCATGG + Intergenic
927062222 2:19434276-19434298 TTCTGCAGACTATACAAGCATGG - Intergenic
927332219 2:21878810-21878832 TTCTACAGGCTATACAAGCATGG + Intergenic
927740193 2:25561802-25561824 TTCTGCAGGCTGTGCAAGCATGG - Intronic
928318822 2:30267105-30267127 TTCTGCAGGCTGTACAGGCATGG + Intronic
928336135 2:30400059-30400081 TTCTGCTGGCTGTGCGTGCAGGG - Intergenic
928425489 2:31174498-31174520 TTCTGCATGCTGGCCATGCACGG + Intronic
928514638 2:32034301-32034323 TTCTGCAAGCTACACAAGCATGG + Intronic
928791157 2:34955862-34955884 TTCTGCAGGCAGTATAAGCATGG + Intergenic
929405040 2:41631756-41631778 TTCTACAGGCTGTACAGGCATGG - Intergenic
929407238 2:41656720-41656742 TTCTACAGGCTGTACAAGCATGG - Intergenic
929547924 2:42868060-42868082 TTCTGCAGGCCGTACAAGCATGG + Intergenic
929565582 2:42982099-42982121 TTCTGCAGGCTGTACAGGCATGG + Intergenic
929695253 2:44109156-44109178 TTCTGCAGGCTGTACAAGCATGG - Intergenic
929894309 2:45945241-45945263 TTCTGCAGGCTGTACAAGCATGG + Intronic
930118428 2:47739962-47739984 TTCTGTAGGCTGTACAAGCATGG + Intronic
930276998 2:49323323-49323345 TTCTGCAGGCTGTACAAGCATGG + Intergenic
930384466 2:50676267-50676289 TTCTATAGGTTATACAAGCATGG - Intronic
930562811 2:52982171-52982193 TTCTGCAGACTATAGAAGCACGG + Intergenic
930727028 2:54692438-54692460 TTCTGCAGGCTGTACAAGCATGG - Intergenic
930906519 2:56574842-56574864 TTCCATAGGCTATACAAGCATGG - Intergenic
931056769 2:58481406-58481428 TTCTGCAGGCTGTACAAGCATGG + Intergenic
931100639 2:58996643-58996665 TTCTGTAGGCTATAAATCCCAGG - Intergenic
931148008 2:59541117-59541139 TTCTGCAAGCTGTACAAGCATGG - Intergenic
931840961 2:66147667-66147689 TTCTGCAGGCTGCACTTGCCAGG + Intergenic
932402333 2:71489619-71489641 TTCTTCAGGGTAGCCATGCATGG + Intronic
932565309 2:72902648-72902670 TTCTGCAGGTTATTCAAACATGG - Intergenic
932903935 2:75729752-75729774 TTCTGCAGGCTATACAAGCATGG - Intergenic
932976497 2:76606485-76606507 TTCTTCAGGCTATATAAACATGG - Intergenic
932982551 2:76687207-76687229 TCCTGCAGGCTGTACAAACATGG - Intergenic
933318909 2:80747276-80747298 CCCTGCAGGCTGTACAAGCATGG - Intergenic
933330266 2:80884648-80884670 TTCTGCAGGCTGTACAAGTATGG + Intergenic
933336635 2:80967411-80967433 CTCTGCAGGCTGTACAAGCATGG + Intergenic
933610902 2:84434116-84434138 TTCTGCAGGCTATACATGCATGG - Intronic
933640015 2:84748850-84748872 TTCTGCAAGCTGTACAAGTATGG + Intronic
934012723 2:87841340-87841362 TTCTGCAGGTTGTACAAGCATGG - Intergenic
934072049 2:88393351-88393373 TTCTACAGGCTATACAAACATGG - Intergenic
934102228 2:88664097-88664119 TTCTGCAGGCCATACGAGCATGG - Intergenic
934158719 2:89227837-89227859 TTCTGCAGGCTGTGCACACATGG - Intergenic
934208556 2:89954590-89954612 TTCTGCAGGCTGTGCACACATGG + Intergenic
934702077 2:96450587-96450609 TTCTGCAGGCTGTACAAGCATGG + Intergenic
934898861 2:98141316-98141338 TTCTGCAGGCTGTGCAAGCAGGG + Intronic
934944288 2:98526736-98526758 TTCTGCAGGCTATACAAGCATGG + Intronic
935150533 2:100431113-100431135 TTCTGCAGGCTGTTCAAGCGTGG + Intergenic
935241390 2:101181324-101181346 TTCTGCAAGCTGTACCAGCATGG + Intronic
935435873 2:103031589-103031611 TTCTGGAGGCTGTAAAGGCAAGG - Intergenic
935526762 2:104180636-104180658 TTCTGAAGGATAGGCATGCATGG + Intergenic
935715936 2:105938945-105938967 TTCTGCAGGCTGTACAAGCATGG - Intergenic
935821204 2:106894650-106894672 TTCTGCAGGCTGTAGAAGCCTGG - Intergenic
936237257 2:110753275-110753297 TTCTGCAGGCTGTACAAGCATGG - Intronic
936256063 2:110913695-110913717 TTCTGCAGGCTATACAAGCATGG + Intronic
936329527 2:111535797-111535819 GTCTGCAGACTGTACAAGCAGGG + Intergenic
936456211 2:112676210-112676232 TTCTGCAGGCTGTACAAACGTGG - Intergenic
936469898 2:112789798-112789820 TTCTGCAGGCTGTACAAGCATGG - Intergenic
936562944 2:113557591-113557613 TTCTGAAGGCTGTACAAGCCTGG + Intergenic
936756866 2:115724760-115724782 TTCTGCAGGTTGTGCAAGCATGG + Intronic
936835991 2:116710153-116710175 TTCTGCAGGCTGTACAAGCATGG + Intergenic
936854816 2:116944668-116944690 GTCTGCAGGCTGTAAAAGCATGG + Intergenic
938494603 2:131787443-131787465 AGCTGCAGGCTGTACAAGCATGG + Intergenic
938592307 2:132751370-132751392 TTCTGCAGGCCGTACAAGCATGG - Intronic
938666459 2:133543319-133543341 TTCTGCTGGTTGTACAAGCATGG - Intronic
938844202 2:135192073-135192095 TTCTGCAGACTGTACCAGCACGG - Intronic
938974302 2:136460619-136460641 TTCTGCAGCCTGTGCAAGCATGG + Intergenic
939023384 2:136984553-136984575 TTCTACAGGCTATACATGCATGG - Intronic
939023654 2:136986496-136986518 TTCTGCAGGCTGTACAAGCATGG - Intronic
939023935 2:136989535-136989557 TTCTGCAGGCTATACAAGCATGG - Intronic
939196059 2:138974107-138974129 TTCTGCAGGCTGTACAAGCATGG + Intergenic
939231204 2:139428235-139428257 TTCTATAGGCTGTACAAGCATGG - Intergenic
939261720 2:139819037-139819059 TTGTGAAGGCTGTACATGCATGG - Intergenic
939678526 2:145102196-145102218 TTCTGCAGGCTGTACAAGCATGG + Intergenic
939833581 2:147101515-147101537 TTCTACAGGCTGTACAAGCATGG + Intergenic
939929079 2:148209670-148209692 TTCTGCAGGCTGTATAAGCATGG + Intronic
939963549 2:148588067-148588089 TTCTGCAGGCTGCACAAGCGTGG + Intergenic
940194682 2:151080568-151080590 TTCTGCAGGCTGTACAAGCATGG + Intergenic
940416453 2:153428228-153428250 TTCTGCAGGCTATACTAGCATGG + Intergenic
940422288 2:153493946-153493968 TTCTATGGGCTATACAAGCACGG + Intergenic
940682839 2:156807657-156807679 TTCCACAGACTATACAAGCATGG - Intergenic
941125836 2:161581984-161582006 TTCTGCAGGCCGTACAAGAATGG + Intronic
941192633 2:162404696-162404718 TTCTGCAGGCTGTACAAGCATGG - Intronic
941266480 2:163368912-163368934 TTCATGAAGCTATACATGCATGG - Intergenic
941370914 2:164662884-164662906 TTCTGCAGGCTGTACAAGCATGG - Intronic
941547550 2:166871278-166871300 TTCTGCAGGCTGTACAAACATGG - Intergenic
941879333 2:170465217-170465239 TTCTGCAGGCTCCACAAGCCTGG + Intronic
941922885 2:170869815-170869837 TTCTGCAGGCTATACAAGCATGG - Intergenic
941984449 2:171496608-171496630 TTCTGCAGGCTGTACAAGCATGG + Intergenic
942212676 2:173687439-173687461 TTCTGGAGTCTATACTTGCATGG + Intergenic
942347330 2:175017086-175017108 TTCTGCAAGCTATACAAGCATGG - Intergenic
942358467 2:175145506-175145528 TTCCACAGGCTATACAAGCATGG - Intronic
942364748 2:175212995-175213017 TTCTGCAGGCTGTACAAGCATGG - Intergenic
942486300 2:176443241-176443263 TTCTGCAGGCTGCACAAGCATGG - Intergenic
942503419 2:176616510-176616532 TTCTGCAGGCTGTACAAGCATGG + Intergenic
942534209 2:176946174-176946196 TTCTGCAGGCTGTACAAGCATGG - Intergenic
942812411 2:180014471-180014493 TTCTGCAGGCTGTATAAGCAGGG - Intergenic
943038922 2:182780477-182780499 TTCTGCAGGCTGTAAAAACATGG - Exonic
943275251 2:185858784-185858806 TTCTGCAGGCTATACATGCATGG + Intergenic
943402675 2:187435176-187435198 TTCTGCAGGCTGTATAAGCATGG + Intronic
943483285 2:188448971-188448993 TTCTGCAGGCTGTCCAAGCATGG - Intronic
943511668 2:188834433-188834455 TCCTGCAGGCTGTACAAGCATGG - Intergenic
943580328 2:189676013-189676035 TTCTGCAGGCTGTACAAGCATGG - Exonic
944160181 2:196651825-196651847 TTCTGCAGGCTGTAAAAACATGG + Intronic
944227163 2:197359671-197359693 TTCTGCAGGCTGTACAAGCATGG + Intergenic
945237015 2:207640368-207640390 TTCTGCAGGCTGTATAAGCATGG - Intergenic
945237793 2:207648379-207648401 TTCTGCAGGCTGTACAAGCAGGG - Intergenic
945304318 2:208244263-208244285 TTCTGCAGGCTGTACAAGCCTGG - Intronic
945315947 2:208370856-208370878 TTCTGCAGGGTGTATAGGCATGG + Intronic
945679117 2:212891630-212891652 TTCTGCAGGCTGTACAAGCATGG - Intergenic
945893075 2:215450837-215450859 TTCTGCAGGCTGTACAAGCATGG - Intergenic
946107132 2:217380969-217380991 TTCTGCAGACTGTACAAGCTTGG + Intronic
946110826 2:217414477-217414499 TGCTTCAGGCTGTACAAGCATGG + Intronic
946486068 2:220102135-220102157 TCCTGCAAGCCGTACATGCATGG + Intergenic
946515183 2:220403718-220403740 TTCTGCAGGCTATACAAGCCTGG - Intergenic
946669083 2:222083120-222083142 TTCTGGAAGCCATACATGAAAGG + Intergenic
946764718 2:223029979-223030001 TTCTGCAAGCTGTACAAGCATGG + Intergenic
946809287 2:223506165-223506187 TTCTGCAGACTGTACAAGCATGG - Intergenic
946819359 2:223614339-223614361 TTCTGCAGGCTGTGCAAGCATGG + Intergenic
946897271 2:224337114-224337136 TTCTGCAGGCTGTACAGGCATGG - Intergenic
946932517 2:224684574-224684596 TTCCACAGGCTGTACAAGCATGG - Intergenic
946936551 2:224727211-224727233 TTCTGCAGGCTGTGCAAACATGG - Intergenic
946941382 2:224773460-224773482 TTCTGCATGCTTTTCATGCATGG + Intronic
947004269 2:225492623-225492645 TTCTGCAGACTGTACATGCGTGG + Intronic
947091894 2:226521319-226521341 TTCTGCAGGCTATACAAGCCTGG + Intergenic
947147899 2:227085516-227085538 TTCTGCAGACTGTACAAGCCTGG + Intronic
947183502 2:227433486-227433508 TTCTGCAGGCTGTACAAACATGG + Intergenic
947197371 2:227582438-227582460 TTCTGTAGGCTATACAAGCATGG - Intergenic
947197518 2:227583667-227583689 TTCTGCAGGCTGTACAAGCATGG + Intergenic
947782831 2:232785038-232785060 TTCTGCAGACTATACAAGCATGG - Intronic
947889491 2:233604555-233604577 TTTTGCAGGCTGTACTAGCATGG + Intergenic
947889757 2:233606629-233606651 TTTTGCAGGCTGCACAAGCACGG + Intergenic
947895175 2:233664489-233664511 TTTTGCAGGCTGTACAAGCATGG + Intronic
948030715 2:234815200-234815222 TTCTGCAGGCTGTACAAGGATGG - Intergenic
948034870 2:234850282-234850304 TTCTGCAGGCTGAACAAGCATGG + Intergenic
948046295 2:234947956-234947978 TTCTGTGGGCTGTACAAGCATGG + Intergenic
949036737 2:241818898-241818920 TTCTGGAGGCTATAAGTCCAAGG + Intergenic
1168988210 20:2069942-2069964 TTCTACAGGCTATACAATCATGG + Intergenic
1169412216 20:5381450-5381472 TTCTGTAGGCTGTGCAAGCATGG + Intergenic
1169467242 20:5852122-5852144 TTCTGCAGGCTGTACAAGCATGG - Intronic
1169617478 20:7465153-7465175 TTATGCAGGCTGTACAAGCAAGG + Intergenic
1169621266 20:7509031-7509053 TTCTGCAGGCTGTACAAGCATGG + Intergenic
1169703651 20:8477587-8477609 TTCTGCAGGCTGTACAAGCTTGG + Intronic
1169763926 20:9128300-9128322 TTCTGCAGGTTGTACAAGCATGG - Intronic
1169948188 20:11011734-11011756 TTCAACAGGAAATACATGCAAGG + Intergenic
1170112149 20:12817058-12817080 TTCTACAGGCTACATAAGCATGG - Intergenic
1170717680 20:18846106-18846128 TTCTGCAGGCTGTACAAGCATGG - Intergenic
1170721277 20:18881384-18881406 TTCTGCAGGCCATACAAGCATGG - Intergenic
1171353370 20:24522735-24522757 TTCTGTAGGCTGTACAAGCATGG + Intronic
1171354526 20:24533942-24533964 TTCTGCAGGCTGTACAGGCACGG + Intronic
1172017752 20:31888686-31888708 TTCTACAGGCTGTACAAGCATGG + Intronic
1172098408 20:32471924-32471946 TTCCACAGGCTGTACAGGCATGG - Intronic
1172878310 20:38179981-38180003 TTCTGCAGGCCATACAAGCGTGG - Intergenic
1172911391 20:38411809-38411831 TTCTTCAGACTGTACAAGCATGG + Intergenic
1173030453 20:39353788-39353810 TTCTGCAGGCTGTACAGGCATGG + Intergenic
1173314361 20:41930293-41930315 CTCTGCAGGCTGTAAAAGCATGG + Intergenic
1173314848 20:41933825-41933847 TTCTACAGGCTGTACAAGCATGG - Intergenic
1173429668 20:42975707-42975729 TTCTGGAGGCTATAGATGGGTGG + Intronic
1173560582 20:44002645-44002667 TTCTGCAGGCTGTATCAGCATGG + Intronic
1173734831 20:45352527-45352549 TTCTGCAGGCTATACAAGCATGG - Intergenic
1173912255 20:46679060-46679082 TTCTGCAGGCTGTACAAGCATGG - Intronic
1173922796 20:46758727-46758749 TTCTGCAGATTATACAAGCATGG + Intergenic
1173958029 20:47049698-47049720 TCCTGCAGGCTGTACAAGCATGG - Intronic
1174060507 20:47829656-47829678 TTCTGCAGGCTGTACAAGCATGG + Intergenic
1174071391 20:47901714-47901736 TTCTGCAGGCTGTACAAGCATGG - Intergenic
1174152662 20:48496947-48496969 TTCTGCAGGCTGTACAAGCATGG + Intergenic
1174225764 20:48998395-48998417 TTCTGCAAGCTGAACATGCGAGG - Exonic
1174444070 20:50578824-50578846 TTCTGCAGGCTGTACAAGCATGG + Intronic
1175569312 20:60006965-60006987 TTCTGCAGGCTAGAAGTCCAAGG + Intronic
1175639054 20:60611480-60611502 TTGTACAGACTATACATACATGG - Intergenic
1175649146 20:60702136-60702158 TTCTGCAGGCTGTACAAGCATGG - Intergenic
1175774561 20:61644833-61644855 TTCTGCAGGCTGGACAGGCCGGG - Intronic
1175852805 20:62102869-62102891 TTCTGCAGGCTGTACAAGCATGG - Intergenic
1176982332 21:15397611-15397633 CTCTGCAGGCTGTACACACATGG - Intergenic
1176985547 21:15431741-15431763 TTCTGCAGGCGATATATGCATGG + Intergenic
1177470416 21:21553848-21553870 TTTTGCAGGCTGTACAAGCATGG - Intergenic
1177517479 21:22174514-22174536 TTCTGCAGGCTGTATAACCATGG - Intergenic
1177773796 21:25545876-25545898 TTCTGCAGGCTGTACAAGCGTGG + Intergenic
1177872624 21:26591600-26591622 TTTTGCAGGCTGTACAAACATGG - Intergenic
1177882084 21:26706214-26706236 TTCTGTAGGCTGTATAAGCATGG + Intergenic
1177966830 21:27738141-27738163 TTCTGCAGGCTATACATGCATGG + Intergenic
1178052475 21:28763266-28763288 TTCTGCATGCTGTACAAGCATGG + Intergenic
1178110701 21:29367223-29367245 TTCTGCAAGTTGTACAGGCACGG - Intronic
1178261080 21:31100284-31100306 TTCTGCAGGTTGTACAAGCATGG + Intergenic
1178326266 21:31647720-31647742 TTCTGCAGGCTGTACAAGCATGG + Intergenic
1178638205 21:34323555-34323577 TTTTTCAGGCTGTACAAGCATGG - Intergenic
1178766037 21:35451806-35451828 TTCTGCAGGCTGTGCAAGCATGG + Intronic
1179190436 21:39118169-39118191 TTCTGCAGGCTGTACAAGCATGG + Intergenic
1179378615 21:40877708-40877730 TTCTGCAGGCTATACAAACAGGG + Intergenic
1179630644 21:42676159-42676181 TTCTGCAGGCTGTATAAGCATGG - Intronic
1179776336 21:43665828-43665850 CTCTGCAGGCTGTACAAGCATGG - Intronic
1179877174 21:44274937-44274959 TTCTGCAGGCTGTACAAGCATGG + Intergenic
1179932057 21:44577379-44577401 TTCTACAGGCTGTACAAGAATGG + Intronic
1180152367 21:45956734-45956756 TTTTGTAGGCTACACAAGCATGG + Intergenic
1180498792 22:15913515-15913537 AGCTGCAGGCTGTACAAGCATGG + Intergenic
1181812536 22:25412641-25412663 TTCTGCAAGCTGTACAAACATGG + Intergenic
1182063658 22:27415710-27415732 TCCTGCAGGCTAGTCATGTATGG - Intergenic
1182307696 22:29382345-29382367 TTCTTAAGGTTGTACATGCATGG - Intronic
1182803174 22:33048698-33048720 TTCTGCAGGCTGTACAAGCATGG - Intronic
1182866629 22:33610038-33610060 TTCTGCAGGCTGTACAAGCATGG - Intronic
1182866923 22:33612030-33612052 TTCTGCAGGCTGCACAAGCATGG - Intronic
1182882191 22:33743174-33743196 TTGTGTAGGCTATACAGGCATGG - Intronic
1182908327 22:33957743-33957765 TTCTGCAGGCTGTACAAGCATGG - Intergenic
1182937387 22:34238196-34238218 TTCTGCAGACTGTACAGGCTTGG + Intergenic
1183488131 22:38100700-38100722 TTCTGCAAACTGTACAAGCATGG - Intronic
1183504888 22:38203271-38203293 TTCTGGAGGCTGTACCTGCTAGG + Intronic
1183659723 22:39212100-39212122 TTCTGCAGGCTGTACCAGCATGG - Intergenic
1184063068 22:42096736-42096758 TTCTGCAGGCTGTGCAAGCATGG - Intergenic
1184319335 22:43727822-43727844 TTCTGCAGGCTGTACAAGCATGG + Intronic
1184447700 22:44560006-44560028 TTCTGCAGACTGTACAACCACGG + Intergenic
1184498739 22:44859469-44859491 TTCTACAGGCTGTACAAGCATGG - Intronic
1184899625 22:47436861-47436883 CTCTGCAAGCTGTACAGGCATGG - Intergenic
1184946088 22:47805161-47805183 TTCTGCAGGCTGTACAGGCATGG + Intergenic
949108101 3:224647-224669 TTCTTCAAGCTGTACAAGCATGG - Intronic
949147454 3:719725-719747 TACTGAAGGCCATACATGCCAGG + Intergenic
949154032 3:807795-807817 TTCTGCAGGCTATACAAGTGGGG - Intergenic
949169269 3:979254-979276 TTCTGCAGGCTAGAAGTTCAAGG - Intergenic
949366616 3:3288551-3288573 TTCTGCAGGCTGTACAAGCATGG - Intergenic
949488961 3:4568871-4568893 TTCTGCAGTCTGTATAAGCATGG + Intronic
949635263 3:5975223-5975245 TTCCACAGGCTGTACAGGCATGG - Intergenic
949706058 3:6818188-6818210 TTCTGCAGGCTGTACAAGTATGG + Intronic
949797274 3:7864587-7864609 TTCTACAGGCTGTACAAGCATGG - Intergenic
949838735 3:8297535-8297557 TTCTGGAGGCTAGAAATCCAAGG + Intergenic
950280283 3:11701372-11701394 TGCTGTAGGCTGTACAAGCATGG - Intronic
950706009 3:14782233-14782255 TTCTACAGGCTGTACAAGCATGG - Intergenic
950811565 3:15654274-15654296 TTCTGCAGGCTCTGCAGGCTGGG + Intergenic
950976338 3:17249625-17249647 TTCTTCAGGCTGTACAAGCCTGG - Intronic
951201832 3:19883908-19883930 TTCTGGAGGCTTGACGTGCAAGG - Intronic
951241108 3:20287342-20287364 TTCTGCAGGCTGTACAAGCTTGG + Intergenic
951949006 3:28177739-28177761 TTCTGCAAGTTGTACAAGCATGG + Intergenic
952010632 3:28897040-28897062 TTCTGCAGGCTGTACAAGCATGG + Intergenic
952102465 3:30030626-30030648 TGCAGCAGTCTATATATGCAAGG + Intergenic
952110932 3:30123238-30123260 TTCTGCAGGCTGTACAAGCATGG - Intergenic
952500983 3:33961808-33961830 ATCTGCAGGCCATACAAGCATGG + Intergenic
952670519 3:35961822-35961844 TTCTGCAGGCTGTACAAGCATGG + Intergenic
952739314 3:36720309-36720331 TTCTGCAGGCTGTACAAGCATGG - Intronic
952868706 3:37877712-37877734 TTCTGCGGGCAGTACAGGCATGG + Intronic
954504061 3:51051743-51051765 TTCTGCAGACTGTACAAGCAAGG + Intronic
955130483 3:56161257-56161279 TTTGGCAGGCTGTACAAGCATGG - Intronic
955167161 3:56526068-56526090 TTCTGCAGGCTGTACAAGCATGG - Intergenic
955167414 3:56527962-56527984 TTCTGCAGGTTGTACAAACATGG - Intergenic
955171423 3:56569313-56569335 TTTTGCAGACTGTACAAGCATGG + Intronic
955577365 3:60380391-60380413 TTCTGCAGGGTGTACAAGCATGG - Intronic
955636513 3:61036080-61036102 TTCTGGAGGCTGTACGAGCATGG + Intronic
955654534 3:61230468-61230490 ATCTTCAGGCTGTACAAGCATGG - Intronic
955659282 3:61279109-61279131 TTCTGCAGAATATACAAGCATGG - Intergenic
955664813 3:61338845-61338867 TTCTGCAGGCTTTACAATCATGG - Intergenic
955799327 3:62669557-62669579 TTCTACAGGCTCTACATTTAAGG - Intronic
956148306 3:66214328-66214350 TTCTGCAGGCTGTACAAGTATGG - Intronic
956235685 3:67068685-67068707 TTCTGCAGGCTCTACAGGAAGGG + Intergenic
956930039 3:74033330-74033352 TTCTACAGGCTGTACAAGCATGG + Intergenic
957011629 3:75012233-75012255 TTCTGCAGGCTGTACAAGAATGG - Intergenic
957576359 3:82013784-82013806 TTCTGCAGGCTGTACAAGCATGG - Intergenic
957616793 3:82539299-82539321 TTTTGCAGGCTGTACATGAATGG - Intergenic
957886198 3:86290543-86290565 TTTTGCAGACTGTACAAGCATGG - Intergenic
958023261 3:88021621-88021643 TTCTGCAGACTGTACAAGCTTGG - Intergenic
958042840 3:88246705-88246727 TTCTGCAGGCTGTACAAGCATGG - Intergenic
959389494 3:105757101-105757123 TTATGCAGGCTGTACAGGCATGG - Intronic
959434618 3:106298822-106298844 TTCTGCAGGCTGTACTAGCATGG - Intergenic
959746555 3:109782022-109782044 TTCTGTAGGCTGTACGGGCATGG + Intergenic
959862146 3:111228697-111228719 TTCTTCAGGCTGTACAATCATGG - Intronic
960250143 3:115442828-115442850 TTCTGCAGGCTGTACAAGTATGG + Intergenic
960521495 3:118660456-118660478 TTCTGCAGGCTGTACAAGCATGG - Intergenic
960591859 3:119374408-119374430 TTCTGCAGGCTGTCCAAGCATGG - Intronic
960636892 3:119793155-119793177 TTCTGAAGGCTGTACAAGCTTGG - Intronic
960694116 3:120379166-120379188 TTTTGCAGACTGTACAAGCATGG + Intergenic
961525316 3:127493140-127493162 TTCTGCAGGCTATACAAGCATGG + Intergenic
961656746 3:128446707-128446729 TTCTGCAGGCTGTACAAGCATGG - Intergenic
961672247 3:128541768-128541790 TTCTGCAGGCTGTACAAGCATGG - Intergenic
961765028 3:129203343-129203365 TTCTGTAGGCTGTACAAGCATGG - Intergenic
962822441 3:139064286-139064308 TTGGGTAGGCTATACATGCCTGG - Intronic
962941927 3:140133044-140133066 TTCAGCAGGCTACACAAGCATGG + Intronic
963041418 3:141072615-141072637 CTCTGCAGGCTGTACAAACATGG - Intronic
963533787 3:146502888-146502910 TTCTTCAGGCTGTACAAACATGG - Intergenic
963803127 3:149697169-149697191 TTCAACAGGCTGTACAAGCATGG + Intronic
963849338 3:150194603-150194625 TTCTGCAGGCTATACCAGCATGG + Intergenic
964092235 3:152891427-152891449 TTCTGCAGGCTGTACAAGCATGG + Intergenic
964161725 3:153653785-153653807 TTGTGCAGGCTGTATAAGCACGG - Intergenic
964246438 3:154659479-154659501 CTCTGCAGGCTCTACTAGCATGG - Intergenic
964452920 3:156829346-156829368 TTCTTCAGGCAACGCATGCATGG - Exonic
964561057 3:157997032-157997054 TTCTGCAGGCTATACAAGCAGGG - Intergenic
964825885 3:160827835-160827857 TTCTACAGGCTGTATAAGCATGG + Intronic
964831826 3:160892203-160892225 TTCTGTAGGCTATACAGGCATGG + Intronic
964903246 3:161686483-161686505 TTCTGCAGGCTGTACAAGCATGG - Intergenic
965341946 3:167502254-167502276 TTCTGCAGGCTGTTCAGGTATGG - Intronic
965781814 3:172294331-172294353 TTCTGCAGGCTGTACAAGCATGG + Intronic
965865294 3:173198409-173198431 TTCTGCAGGATATACAAGCATGG + Intergenic
965865554 3:173200496-173200518 TTCTGCAGGATATACAAGTATGG + Intergenic
966000653 3:174944518-174944540 GTCTGCAGGCCATACTTCCATGG - Intronic
966296778 3:178432830-178432852 CTCTGCAAGCTATACAAGCATGG - Intronic
966457939 3:180139459-180139481 TTCTGCAGATTATACAAGGATGG + Intergenic
966569775 3:181428653-181428675 TTCTGCAGGCTATGTAAGCATGG + Intergenic
966675254 3:182579312-182579334 TTCTGCAGGCTGTACAAGCATGG + Intergenic
966728413 3:183130043-183130065 TTCTGGAGGCTAGAAATTCAAGG - Intronic
966936657 3:184714580-184714602 ATATGCAGGAGATACATGCACGG + Intergenic
966989773 3:185217688-185217710 TTCCGCAGGTTGTACAAGCATGG - Intronic
967186934 3:186952068-186952090 TTCTGCAGGCTGTACAGGCATGG + Intronic
967193326 3:187004230-187004252 CTCTGCAGGCTGCACAAGCATGG - Intronic
967324366 3:188224588-188224610 TTCTGCAGTCTGTATAAGCATGG + Intronic
967504934 3:190243472-190243494 TTCTGCAGGCTGTACAAAGATGG + Intergenic
967806129 3:193715993-193716015 TTCTGTAGGCTGTACAAACATGG - Intergenic
968780925 4:2580779-2580801 TTCTGTAGGCTATACAAGCATGG - Intronic
968981058 4:3849711-3849733 TTCTGTGGGCTGTACAAGCATGG + Intergenic
969082435 4:4629260-4629282 TTCTGCAGGCTGTACAGGCACGG - Intergenic
969543518 4:7808927-7808949 TTCTGCAGGCTATACAAGTATGG - Intronic
969553006 4:7884227-7884249 TTCTGCAGGCTTTACAAGCATGG - Intronic
969850457 4:9952456-9952478 TTCTGCAGACTGTACATGCATGG - Intronic
970015463 4:11507725-11507747 TTCTGCAGGCTGTACAAGCATGG + Intergenic
970062384 4:12049801-12049823 TTCTGCAAGCTGTACAAGTATGG - Intergenic
970249635 4:14100686-14100708 TTCTGCAGGCTGTACAAGCATGG + Intergenic
970298530 4:14657554-14657576 TTCTGCAGGCTCTTCAAGCAGGG - Intergenic
970791290 4:19860896-19860918 TTCTGCAGGTTGTACAAGCATGG - Intergenic
971376229 4:26057889-26057911 TTCTGCAGGCTGTACAAGCATGG + Intergenic
971455914 4:26843763-26843785 TTCTGCAGGCTGTACAAGCAGGG + Intergenic
971524802 4:27603623-27603645 TTCTGCAGGAAGTACAAGCATGG + Intergenic
971976019 4:33687972-33687994 TTCTGCAGGCTATGCAAGCATGG - Intergenic
971993149 4:33928074-33928096 TTCTGCAGGCTGTGTAAGCATGG + Intergenic
972161933 4:36237673-36237695 TTCTGCAGGCTGTACAAGCATGG - Intronic
972211938 4:36848901-36848923 TTCTGCAGGCTGTAGAAGCATGG - Intergenic
972300311 4:37779308-37779330 CTCTGCAGGCTGTAGAAGCATGG - Intergenic
972341032 4:38152724-38152746 TTCTGCAGGCTGTACAAACATGG + Intergenic
972788015 4:42345542-42345564 TTCAGCAGGCTACAGATGGAAGG + Intergenic
973009996 4:45060979-45061001 TTCTGTAGGCTGTGCAAGCATGG - Intergenic
973614502 4:52665201-52665223 TTCTGCAGGCTACACAAGCATGG + Intergenic
973665153 4:53151789-53151811 TTCTGCAGGTTGTACAAGCATGG + Intronic
973665439 4:53154244-53154266 TTCTGCAGGCTGTACAAGCATGG + Intronic
973765202 4:54155906-54155928 TTCTACAGGCTGTACAGGCATGG + Intronic
973854423 4:54996629-54996651 TTCTGCAGGCTGTACAGGTTGGG + Intergenic
973979093 4:56291760-56291782 TTCTGCAGGCTATATAAGCATGG - Intronic
974192095 4:58518815-58518837 TTCTGCAGGTTGTACAAGTATGG + Intergenic
974297941 4:60027849-60027871 TTCTGCAGGCTGTACAAGCATGG + Intergenic
974325528 4:60409322-60409344 TTCTGCAGGCTGTACAAGCATGG - Intergenic
974441602 4:61925510-61925532 TTCTGCAGGCTCTACAAGCATGG + Intronic
974452001 4:62076033-62076055 TTCTGCAGGCTGTAAATAAATGG - Intronic
974488589 4:62534901-62534923 TTCTGCAGGCTCTACAAGCATGG + Intergenic
974580555 4:63794977-63794999 TTCTGCAGGCTGTACAAGCATGG - Intergenic
975069985 4:70122575-70122597 TTCTGCAGCTTTTAGATGCATGG - Intergenic
975412708 4:74073486-74073508 TTCTGAAGGCTGAACATCCAAGG + Intergenic
975610022 4:76194192-76194214 TTCTGCAGGCTGTACACACATGG - Intronic
975673978 4:76808809-76808831 TTCTGCAGGCTGTACGAGCATGG + Intergenic
976013098 4:80516396-80516418 TTCTGTGGGCTATACAAGGATGG + Intronic
976015419 4:80546810-80546832 TTCTGCAGGCTGTACAAACATGG - Intronic
976133602 4:81911221-81911243 TTTTGCAGGCTGTACAAGCATGG - Intronic
976327022 4:83783370-83783392 CTCTGCAGGCCATACTAGCATGG + Intergenic
976411692 4:84720702-84720724 TTCTACAAGCTGTACAAGCATGG - Intronic
976589459 4:86834765-86834787 TTCTGCAGGCTGTACAAGCATGG + Intronic
976895796 4:90109275-90109297 TTCTGCAGGCTGGACAGGTATGG - Intergenic
977154962 4:93560314-93560336 TTCTGCAGGCTATACAAACATGG + Intronic
977325177 4:95565549-95565571 TTCTGCAGGCTGTACAAGCATGG - Intergenic
977361851 4:96015632-96015654 TTCTGCAGGCTGCACAAGCGTGG + Intergenic
977386815 4:96350717-96350739 TTCTGCAGGCCATATATTCCAGG - Intergenic
977612674 4:99052402-99052424 TTCTGCAGGCTATACAAGCATGG + Intronic
977707489 4:100087669-100087691 TTTTGCAGACTGTACAAGCATGG + Intergenic
977720015 4:100229093-100229115 TTCTGCCAGCTGTACAAGCATGG - Intergenic
977780553 4:100976420-100976442 TTCTGCAGGCTGTAAGTTCAAGG + Intergenic
977902492 4:102438241-102438263 TTCTGCAGGCTGTACAAGCATGG - Intergenic
978100798 4:104839061-104839083 TTCTACAGGCTGTACAAGCATGG - Intergenic
978408757 4:108406717-108406739 TTCTGCAGGCTGTATAAGCATGG + Intergenic
978712442 4:111800688-111800710 TTCTGCAGGCTGTACCAGCATGG + Intergenic
978968193 4:114768690-114768712 TTCTGGAGGCTAGAAATTCAAGG - Intergenic
979056640 4:116003290-116003312 TTCTGCAGGGTGTACAAGAAAGG + Intergenic
979234552 4:118385192-118385214 TTCTGCGGGCTGTACAAGCATGG - Intergenic
979743989 4:124186502-124186524 TTCTGCAGGCTGTACAACAATGG - Intergenic
979985067 4:127303814-127303836 GTCTGCAGGCTATACAAGTCTGG + Intergenic
980009221 4:127577918-127577940 TTCTGCAGGCTGTACAAACATGG + Intergenic
980219524 4:129897966-129897988 TTCTGCAGGCTGTATAAGCATGG + Intergenic
980613884 4:135193882-135193904 TTCTGCAGGCTGTACAAGCATGG - Intergenic
980614110 4:135195436-135195458 TTCTGCAGGCTGTACAAGCATGG - Intergenic
980811098 4:137881786-137881808 TTCTGCAGACTGTACAGACATGG + Intergenic
980876609 4:138668012-138668034 TTCTTCAGACTATACAAGCATGG - Intergenic
981052509 4:140323346-140323368 TTCTGCAGGCTGTACAAGCATGG - Intronic
981062495 4:140440039-140440061 TTCTGCAGGCTGTATAAACATGG - Intergenic
981066205 4:140488971-140488993 TTCTGCAGGCCCTACAAACATGG - Intronic
981262714 4:142741215-142741237 TTCTGCAGGCTATACAAGAATGG + Intronic
981689128 4:147486961-147486983 CTCTGTAGGCTGTACATGCATGG + Intronic
981769395 4:148290068-148290090 TTCTGGAGGCTAGAAATGCAAGG + Intronic
982041858 4:151405525-151405547 TTCTGCAAGCTGTACAAGCATGG + Intergenic
982162765 4:152586513-152586535 TTCAGCAGTCTGTACAAGCATGG - Intergenic
982162917 4:152587687-152587709 TTCTGCAGGCTGTAAAAGCATGG - Intergenic
982178032 4:152725098-152725120 TTCTGCAGGCTGTACAAGCATGG + Intronic
982282560 4:153699973-153699995 TTCTGCAGGCTGTACAAGCATGG + Intergenic
982307090 4:153944079-153944101 TTTAGCAGGCTGTACAAGCATGG + Intergenic
982386114 4:154804126-154804148 TTCTGTAAGCTTTACAAGCATGG - Intronic
982621347 4:157710051-157710073 TTCTGCAGGCTGTCCAAGCATGG + Intergenic
982775897 4:159441028-159441050 TTCTGCAGGCTGTACAAGCATGG - Intergenic
983141013 4:164149209-164149231 TTCTGCAGGATGTACAAACATGG - Intronic
983165164 4:164467373-164467395 TTCTGCAGGCTGTACAAGCATGG + Intergenic
983256127 4:165402680-165402702 TTCTGCAGGCTGTACAAGCATGG - Intronic
983343461 4:166497019-166497041 GTCTGCAGGCTCTACATACCGGG + Intergenic
983353345 4:166622939-166622961 TTCTTCAGGTTATACAAGCATGG + Intergenic
983449267 4:167890290-167890312 TTCAACAGGCTGTACAAGCAGGG - Intergenic
983468220 4:168122578-168122600 TTCTGCAGGCTGTACAAGCATGG + Intronic
983524719 4:168749256-168749278 TTCTGCAGGATGTACAGGCATGG - Intronic
983698277 4:170559578-170559600 TTCTGCAGGCTGTACAAACATGG - Intergenic
983914632 4:173279155-173279177 TTCTGCAGGCTGTACAAGCATGG + Intronic
984235529 4:177152943-177152965 TTTTGCTGGCTGTACAAGCATGG - Intergenic
984367699 4:178820345-178820367 TTCTGCAGGCTGTACAAGCATGG + Intergenic
984591898 4:181626445-181626467 TTCTGCAGGCTGCACAAGCATGG + Intergenic
984744032 4:183196166-183196188 TTCTGCAGGATATACAAGCACGG - Intronic
985008692 4:185560320-185560342 TTCCGCAAGCTGTACAAGCATGG - Intergenic
985195884 4:187428982-187429004 TTCTGCAGGCTGTACCAGTATGG + Intergenic
985235707 4:187871584-187871606 TTCTGCAGGCTGTACAAGCATGG - Intergenic
985636939 5:1040423-1040445 TTCTGCAGGCTGTACAAGCATGG - Intergenic
985809424 5:2072107-2072129 TTCTGCAGGCTGTACAAGCATGG - Intergenic
985906095 5:2838258-2838280 CTCTGCAGGTTGTACAGGCATGG + Intergenic
985953764 5:3244476-3244498 TTCTGCAGGCTGTAGAAGCACGG + Intergenic
986138707 5:5008665-5008687 TTCTGCAGGCTGTACAAGCTTGG - Intergenic
986345985 5:6835679-6835701 TTCTGCAGGCTGTACAAGCCGGG - Intergenic
986399623 5:7368324-7368346 TTCTGAAGGTTGTACAAGCATGG - Intergenic
986590848 5:9367997-9368019 TTCTGCAGGCTGTACAAGCATGG - Intronic
986648179 5:9938900-9938922 TTCTGCAGACTGTACAAGCATGG + Intergenic
986944668 5:13001343-13001365 TTCTGAAGGCTGGAAATGCAAGG + Intergenic
987144413 5:14978457-14978479 TTCTGCAGGCTGTACAAGCATGG + Intergenic
987220377 5:15784774-15784796 TTCTGCAGGCTGTACAAGCATGG - Intronic
988262900 5:28911916-28911938 TTCTCCAGGCTGTAAAAGCATGG - Intergenic
988549333 5:32185975-32185997 TTCTGCAGGCTGTACAAGCATGG - Intergenic
988724500 5:33912679-33912701 TTCTGCAGGTTGCACAAGCATGG + Intergenic
988833123 5:35006383-35006405 TTCTACAGGCTGTACAAGCATGG + Intronic
988924656 5:35977653-35977675 TTCTGCAGGCTGTACAAGCATGG - Intronic
989042173 5:37240400-37240422 TTCTGCAGGCTGTGCAAGCATGG + Intronic
989111305 5:37908717-37908739 TTCTGCAGGCTGTACAAGCATGG - Intergenic
989307992 5:39979803-39979825 TTCTGCAGGCTGTACTAGCATGG - Intergenic
989393396 5:40925689-40925711 TTCTGTAGGCTGTACAAGCATGG + Intronic
989448085 5:41554464-41554486 TTCTGCAGGCCATACAAGCATGG - Intergenic
989460476 5:41692216-41692238 ATCTGCAGGCTGTACAAGCATGG - Intergenic
989460491 5:41692393-41692415 TTCTACAGGCTGTACGAGCATGG + Intergenic
989506643 5:42233196-42233218 TTCTGCAGGCTGTTCAAACATGG - Intergenic
989545736 5:42671173-42671195 TTCTGCAGCCTGTACAAGCATGG + Intronic
989726375 5:44591256-44591278 TTCTTCAGGCTGTACCAGCATGG - Intergenic
990002700 5:50912997-50913019 TTCTGCAGGGTGTACAAACATGG - Intergenic
990114168 5:52368275-52368297 TTCTTCAGGCTGGACAAGCATGG - Intergenic
990130382 5:52574909-52574931 TTCTGCAGGCTGTGCAAGCATGG - Intergenic
990222335 5:53606253-53606275 TCCTGCAGGCTGCACAAGCATGG + Intronic
990619089 5:57540539-57540561 TTCTGCAGGCTGTACAAGCATGG - Intergenic
990785089 5:59409686-59409708 TTCTGCAGGATGTACAAGCATGG - Intronic
990989361 5:61670134-61670156 TTCTGCAGGCTATACAAGCATGG + Intronic
991008224 5:61853367-61853389 TTCTGCAGGCTGTACAAGCATGG + Intergenic
991085645 5:62646391-62646413 TTCTGCAGGCTGTGCAAGCATGG + Intergenic
991224338 5:64252222-64252244 ATCAGCTGGCTGTACATGCATGG - Intronic
991259745 5:64653764-64653786 TTCTTCAGGCTGTACAAGCATGG - Intergenic
991605879 5:68400499-68400521 TTCTACAGGCTGTACAAGCGTGG - Intergenic
991643643 5:68778960-68778982 TTCTGCAGGCTGTACAAGCATGG + Intergenic
992208330 5:74452635-74452657 TGCTGCAGGCTGTACAAGCATGG - Intergenic
992345947 5:75878880-75878902 TTCTGAAAGCTGTACAAGCATGG + Intergenic
992558042 5:77922340-77922362 TTCTGCAGGCTATACAAGCATGG - Intergenic
992647389 5:78824167-78824189 TTCTGCAGGCTGTACAAGCATGG - Intronic
992780294 5:80121247-80121269 TTCTACAGGCTGCACAAGCAAGG + Intronic
992780350 5:80121691-80121713 TTCTGCAGGCTGTACAACCATGG + Intronic
992876395 5:81059922-81059944 TTCTGCAGGCTGTACAAGCATGG + Intronic
993198401 5:84781150-84781172 TTCTGTAGGCTGTACAAGCATGG + Intergenic
993446593 5:88020339-88020361 CTCTGCAGACTGTACAAGCATGG + Intergenic
993468863 5:88282082-88282104 TTCTGCAGGCTGTAGAAGCACGG - Intergenic
993539768 5:89134610-89134632 TTCTGCAGCTTGTACAAGCATGG + Intergenic
994138738 5:96319027-96319049 TTCTGCAGGCTGTAGAAGCATGG + Intergenic
994500068 5:100564156-100564178 TTCTGCAGACTATACAAGCATGG - Intronic
994696769 5:103081223-103081245 ATCTGCAGGTTTTACATCCATGG - Intergenic
995059217 5:107795709-107795731 TTCTGCAGGCTGTGCAAACATGG + Intergenic
995082806 5:108073886-108073908 TTCTGCAGGCAGTAGAAGCATGG - Intronic
995181734 5:109236147-109236169 TTATGCAGGCAGTACAAGCATGG - Intergenic
995250292 5:109985414-109985436 TTCTTCAGGCTGTATAGGCATGG + Intergenic
995460760 5:112400419-112400441 TTCTACAGGCAGTACAAGCACGG + Intronic
995648929 5:114345716-114345738 TTCTGCAGGCTATACAAGCATGG + Intergenic
995761253 5:115564610-115564632 TTCTGCAGGCTGTACAAGCATGG - Intergenic
995761519 5:115566653-115566675 TTCTGCAGGTTGTACAAGCATGG - Intergenic
996004804 5:118406824-118406846 TTCTGCAAGCTGTATATGCATGG + Intergenic
996090266 5:119344159-119344181 TTCTGCAGGCTATGCAAGCATGG + Intronic
996217679 5:120888937-120888959 TTCTGAAGGCTGTACAAGCATGG - Intergenic
996251621 5:121342274-121342296 TTCTGCAGACTGTACAAGTATGG + Intergenic
996722311 5:126641760-126641782 TTGTGCAGGCTGTAGAAGCATGG - Intergenic
996869944 5:128179514-128179536 TTCTGCAGACCACACAAGCATGG + Intronic
997779776 5:136644838-136644860 TTCTGCAGGTTGTACAGGAAGGG - Intergenic
997850848 5:137331524-137331546 TTCTGCAGGCTGTATAAGCATGG + Intronic
998018283 5:138750424-138750446 TTCTGCAGGCTGTATAAGCAAGG + Intronic
998072105 5:139205959-139205981 TTCTGCAGGCTGTACAAGCATGG - Intronic
998217664 5:140249632-140249654 GTCTGCAGGCTATACAAGCATGG + Intronic
998327146 5:141291313-141291335 TTCTACAGGCTATATAATCATGG + Intergenic
998711713 5:144833413-144833435 TTTTGCAGACTATACAAGTATGG + Intergenic
999107662 5:149087795-149087817 TTCTGCAGGCTGTACAAGCATGG - Intergenic
999114276 5:149148804-149148826 TCCTGCTGACTTTACATGCATGG + Intronic
999648984 5:153747143-153747165 TTCTGTGGGCTATACAAGCATGG + Intronic
999742529 5:154567184-154567206 TTCTGCAGGCTCAATAAGCATGG + Intergenic
999843162 5:155450591-155450613 TTCTACAGGCTGTACAGGCATGG + Intergenic
999900856 5:156085525-156085547 TTCTGCAGGCTGTACATGCATGG - Intronic
999908300 5:156167794-156167816 TTCTACAGGCTGTACAAGCATGG - Intronic
1000101098 5:158017284-158017306 TTCTGCAGGCTGTACAAGCATGG - Intergenic
1000402014 5:160839069-160839091 TTCTGCAGGCTGTACAAGCATGG - Intronic
1000830060 5:166092131-166092153 TTCTGCAGGCTATGCAAGCATGG + Intergenic
1001061843 5:168497565-168497587 TTCTGCAGGCTGTACAAGCATGG + Intronic
1001078542 5:168649363-168649385 TTCTGCAGGCTGTACAATCATGG + Intergenic
1001184603 5:169556770-169556792 TTTTGCAGGCTGTACTTGTATGG - Intergenic
1001927453 5:175648914-175648936 TTCTGCTGGCTGTACAGGCCTGG + Intergenic
1002658637 5:180774102-180774124 TTCTGCAGGCTGAACAGGCAGGG + Intergenic
1003152809 6:3566790-3566812 TTCTGCAGGCTGTACGAGCATGG - Intergenic
1003439409 6:6125196-6125218 TTCTGCAGGCTATATAAGCATGG - Intergenic
1003744881 6:8989625-8989647 TTCTGCTGGCTGTATAGGCATGG + Intergenic
1003788894 6:9520391-9520413 TTCTGCAGACCATACAAGCATGG + Intergenic
1004315929 6:14587654-14587676 TTCTACAGGCTGTACAAACATGG + Intergenic
1004455229 6:15785738-15785760 TTCTGCAGGCTATACAAGCATGG - Intergenic
1004472599 6:15942546-15942568 TTCTGCAGGCTGTACCAACATGG + Intergenic
1004478086 6:15992887-15992909 TTCTGCAGGCTCTACAAACATGG - Intergenic
1004602444 6:17163332-17163354 TTCTACAGGCTGTATAAGCATGG - Intergenic
1004700098 6:18070470-18070492 TTCTGCAGGCTGTACAAGCATGG - Intergenic
1004762126 6:18678664-18678686 TTCTGCAGTCTGTACAAGCATGG - Intergenic
1004804206 6:19184215-19184237 TTCTGCAGGCTGTACAAGCATGG - Intergenic
1004882531 6:20023036-20023058 TTCTGCAGGCTGTACAAGCATGG - Intergenic
1005423195 6:25673852-25673874 TTCTGCAGGCTGTACAAGCATGG + Intronic
1005573408 6:27169015-27169037 TTCCGCAGGCTATACAAGCATGG - Intergenic
1005597496 6:27393456-27393478 TTCTTCAGGCTGTACAACCATGG - Intronic
1005597775 6:27395479-27395501 TTCTGCAGGCTGTAAAAGCATGG - Intronic
1005834428 6:29697066-29697088 TTCTGCAGGCTGTACAATCATGG - Intergenic
1006593465 6:35175531-35175553 TTGTGCAGGCTATAGAGGCCGGG + Intergenic
1007212080 6:40201535-40201557 TTATGCAGGCTGTTCAAGCATGG - Intergenic
1007225301 6:40309528-40309550 TTCTGCAGGCTGTACAAGAATGG + Intergenic
1008098949 6:47370924-47370946 TTCCACAGGCTGTACAAGCATGG - Intergenic
1008113286 6:47517242-47517264 TTCTGCAAGCTATACAAGCATGG - Intronic
1008189760 6:48439845-48439867 TTCTGCAGGCTGTACAAGCATGG - Intergenic
1008189861 6:48441412-48441434 TTCTGCAGGCTCTATAAGCATGG + Intergenic
1008280397 6:49589138-49589160 TTCTGCAGGCTGCACAATCATGG - Intergenic
1008306680 6:49911299-49911321 TTCTGCAGGCTGTACAAGCATGG + Intergenic
1008418581 6:51271464-51271486 TTTAGCAGGCTGTACAAGCATGG - Intergenic
1008513148 6:52296063-52296085 TTCTGCAGGTTGTACAAGCATGG - Intergenic
1008652712 6:53579405-53579427 TTCTGCAGGCTGTACAAGCATGG + Intronic
1008691405 6:53983336-53983358 TTCTGCAGGCTGTATAAGCATGG + Intronic
1008830013 6:55747524-55747546 TTCTTTAGGCTATACAAACATGG - Intergenic
1008898296 6:56582520-56582542 TTCTACAGGGTCTACAAGCATGG - Intronic
1009873346 6:69474986-69475008 TTCTGCAGGCTGTACAAGCACGG - Intergenic
1010022678 6:71178909-71178931 TTATGCAGGCTGTGCAAGCATGG - Intergenic
1010266578 6:73874787-73874809 TTCTGTAGGCTGTACAAGCTTGG + Intergenic
1010430289 6:75770224-75770246 TCCTGCAGGCTGTATAAGCAGGG - Intronic
1010449313 6:75984956-75984978 TTCTGCAGGCTGTACAAACATGG - Intronic
1010990722 6:82477260-82477282 TTCTGCAGACTGTACAAGCATGG + Intergenic
1011346265 6:86372348-86372370 TTCTGCAGGCTGTACAAGCATGG - Intergenic
1011371229 6:86638843-86638865 TTCTGCAGGCTGTACAAGCATGG - Intergenic
1011531896 6:88332081-88332103 TTGTGCAGGATATACAAGCATGG + Intergenic
1011781915 6:90799280-90799302 TTCTGCAGGCTGTACAAGCATGG + Intergenic
1011821812 6:91261998-91262020 TTATGCAGGCTGTACAAGCATGG + Intergenic
1011846371 6:91567958-91567980 TTCTGCAGGCCATATAAGCATGG - Intergenic
1011898538 6:92262391-92262413 TTCTGCAGGCTGTACAAGCATGG - Intergenic
1011947733 6:92927833-92927855 TTCTGCAGGCTATACAAGTGTGG - Intergenic
1011996789 6:93599589-93599611 TTCTGCAGGCTGTACAAGCATGG - Intergenic
1012053428 6:94373478-94373500 TTTTGCAGGCTGGACAAGCATGG + Intergenic
1012124943 6:95417233-95417255 TTCTGCAGGCTGTACAAGCATGG - Intergenic
1012397678 6:98818714-98818736 TTCTGCAGCCTGTACAATCATGG + Intergenic
1012402770 6:98857916-98857938 TTCTGCAGGCTGTACAAGCATGG + Intergenic
1012528359 6:100204517-100204539 TTCTGCAGGCCATACAAGAATGG + Intergenic
1012676963 6:102127359-102127381 TTCCGCAGGCTGTATAAGCATGG + Intergenic
1013161253 6:107547536-107547558 TACTGCAGGCTATACAAATATGG + Intronic
1013264442 6:108481028-108481050 TTCTGAAGGCTGTACCTCCAGGG + Intronic
1013486766 6:110604157-110604179 TTCTGCAGGCCATACAAGCATGG - Intergenic
1013729655 6:113149478-113149500 TTCTGTAGGCTGTATAAGCATGG - Intergenic
1014051688 6:116962510-116962532 TTCTGCAGGCTGTACAAGCACGG - Intergenic
1014136590 6:117896596-117896618 TCCTGCAGGCTTTATAAGCATGG - Intergenic
1014172855 6:118298127-118298149 TTCTGTAGGCTGTATAAGCATGG - Intronic
1014266052 6:119278927-119278949 TTCTGCAGTCTGTATAAGCAAGG - Intronic
1014330649 6:120059778-120059800 TTCTGCAGGCTGTACAGGCATGG + Intergenic
1014587110 6:123212434-123212456 TTCTGTAGGCTGTACAAGCATGG + Intergenic
1014835339 6:126155113-126155135 TTCTGCAGCCTATACAAGCATGG + Intergenic
1014835557 6:126156614-126156636 TTCTGCAGGCTGTACAAGCATGG + Intergenic
1014858219 6:126429597-126429619 TTCTGCAGGCTGTACATGCATGG - Intergenic
1015027659 6:128556139-128556161 TTCTGCAGGTTGTACAAGCATGG - Intergenic
1015218996 6:130782549-130782571 TTCTGCAGGCTGTACAAACATGG - Intergenic
1015323189 6:131898878-131898900 TTCTGCAGGCTATGTAAGCATGG + Intergenic
1015489858 6:133812714-133812736 TTCTGAAGGCTGTACAAGCATGG + Intergenic
1015748395 6:136535352-136535374 ATCTGCAGGCTGTACAAGCGTGG - Intronic
1015804176 6:137091907-137091929 TTCTGCAGGCTGTACAAGCATGG - Intergenic
1015907814 6:138135864-138135886 TTTTGCAGGCTGTGCAAGCATGG - Intergenic
1016141758 6:140620981-140621003 TTCTGCAGGCTGTACAAGCATGG - Intergenic
1016564271 6:145435086-145435108 TTCTGCAGGCTGTACAAGCATGG - Intergenic
1017019056 6:150125583-150125605 TCCTGCAGGCTGTACATGCATGG - Intergenic
1017121925 6:151032244-151032266 TTCTGAAGGCTGTGCAAGCATGG + Intronic
1017190970 6:151652276-151652298 TTCTGCAGCCTATACAAGCAGGG + Intergenic
1017392527 6:153957317-153957339 TTCTGCAGGCTGTACAAGCATGG + Intergenic
1017458283 6:154623455-154623477 TTCTGCAGGCTGTACAAGCATGG + Intergenic
1017553788 6:155541230-155541252 TTCTGAAGGCTGTACAAACATGG - Intergenic
1017925295 6:158906633-158906655 TTTTGCAGGCTATACATGCATGG - Intronic
1018161226 6:161044721-161044743 TTCTGTATGCTATACAAGCGTGG + Intronic
1018481416 6:164194883-164194905 CTCCGCAGGCTATACAGCCACGG + Intergenic
1019141234 6:169945209-169945231 TTCTGCAGGTTGTGCAAGCATGG + Intergenic
1019204685 6:170350216-170350238 TTCTGCAGGCTGCACTTCCATGG + Intronic
1020414289 7:7928474-7928496 TTCTGCAGGCTATACAGGCATGG + Intronic
1020502866 7:8944952-8944974 TTCTGCAGGCTGTACAAGGATGG + Intergenic
1020534777 7:9382920-9382942 TTCTTCAGGCTGTACAAGCATGG - Intergenic
1020731895 7:11891423-11891445 TTCTACAGGCTGTACAAGTATGG - Intergenic
1020732130 7:11893372-11893394 TTCTGCAGGTTGTACAGGCATGG - Intergenic
1021530215 7:21635586-21635608 TTCTGCCTGCAATAGATGCAGGG + Intronic
1021539550 7:21742307-21742329 TTCTGCAGGCTGTGCTAGCATGG + Intronic
1021660018 7:22910430-22910452 TTCTGCAGGCTGTACAAGCATGG - Intergenic
1021706596 7:23374015-23374037 TTCCTCAGGCTATACCAGCATGG - Intronic
1022293400 7:29025251-29025273 TTCTGTAGGCTATACAAGTATGG + Intronic
1023096422 7:36664775-36664797 TTCTGCAGGCTGTACAAGCATGG + Intronic
1023239927 7:38133326-38133348 TTCTGCAGGCTGAAGAAGCATGG + Intergenic
1023781863 7:43663271-43663293 TTCTGCAGGCTGTACAGGTGTGG - Intronic
1023986142 7:45097615-45097637 TTCTGCAGGCTGTACAAGCATGG + Intergenic
1024034978 7:45500339-45500361 TTCTGCAGGCTGTACAAGCATGG + Intergenic
1024596915 7:50946298-50946320 TTCTGCAGGCTACACAAGCATGG + Intergenic
1025234427 7:57224367-57224389 TTCTGCAGGCTGTACAGGCATGG - Intergenic
1025242146 7:57286004-57286026 TTCTGCAGGCTGTATAAGCATGG + Intergenic
1025726440 7:64065865-64065887 TGCTGCAGGTTATAAATTCATGG - Intronic
1026058622 7:67006817-67006839 TTCTGCAGGCTCTACAAGCATGG + Intronic
1026449414 7:70514363-70514385 TTCTACTGGCTGTACAAGCATGG + Intronic
1026451228 7:70531454-70531476 TTCTGCAGGCTTTGCAAGCATGG + Intronic
1026454084 7:70555744-70555766 TTCTGCAAGCCATAAAAGCATGG + Intronic
1026558234 7:71426524-71426546 TTCTGCAGGCTGTACAAACCTGG + Intronic
1026619050 7:71934424-71934446 TTCTGCAGGATGTACAAGCATGG + Intronic
1026655223 7:72250812-72250834 TTCTGCAGGCTATACGAGCGTGG - Intronic
1026672162 7:72400043-72400065 TTCTGCAGACTGTACAAGAAGGG - Intronic
1026719472 7:72818201-72818223 TTCTGCAGACTGTACAAGCATGG - Intronic
1027491688 7:78834980-78835002 GTCTGCAGGCTGTACAAGCATGG - Intronic
1027880468 7:83828993-83829015 TTCTGCAGGCTGTACAAGTATGG - Intergenic
1027937639 7:84630885-84630907 TTCTGCAGGGAATACAAGCATGG + Intergenic
1027944936 7:84732724-84732746 TTCTGCAGGCTGTACAAGTATGG + Intergenic
1027949738 7:84799664-84799686 TTCTGTAGGCTATACAAGCATGG - Intergenic
1027991555 7:85369419-85369441 TTCTGCAGGCTGTAAAAGCAAGG + Intergenic
1028216506 7:88139964-88139986 TTCTGCAGGCTGTACAAGCATGG + Intronic
1028440064 7:90849339-90849361 TTCTACAGGCTATATAAGCATGG - Intronic
1028516066 7:91679541-91679563 TTCTGCAGGCTGTACAAGCATGG + Intergenic
1028913986 7:96238354-96238376 TTCTGGAGGCTAGACATCCAAGG - Intronic
1028933177 7:96437422-96437444 TTCTGCAGGCTATACAAGCATGG + Intergenic
1029065419 7:97843481-97843503 TTCTGCAGGCTGTACAAGCATGG + Intergenic
1029981167 7:104880371-104880393 TTCTGCAGGCTGTACAAGCATGG - Intronic
1030022130 7:105285809-105285831 TTCTGCAGGCTTTACAAGCATGG - Intronic
1030149176 7:106385852-106385874 TTCTGCAGGCTGTGCAAGCCTGG + Intergenic
1030371132 7:108700351-108700373 TTCCACAGACTATACAAGCATGG - Intergenic
1030750448 7:113226099-113226121 TTCTTCAGGCTATACAAACATGG - Intergenic
1030917262 7:115330858-115330880 TTCTGCAGGCTGTACAAGCATGG + Intergenic
1031244251 7:119287843-119287865 TTCTGCAGGTTGTACAAGCATGG + Intergenic
1031356618 7:120794596-120794618 TTCTGCAGGCTGTACAGGAAAGG - Intronic
1031372732 7:120987609-120987631 CACTGGAGGCGATACATGCAAGG + Intergenic
1031382247 7:121101652-121101674 TTCTGCAGGCTGTACAAGTATGG + Intronic
1031394959 7:121262237-121262259 TTCTGCAGGCTATACAAGCATGG - Intronic
1031574585 7:123400030-123400052 TTTTGCAGGCTGTACAAACATGG - Intergenic
1031618412 7:123907074-123907096 TTTTGCAGGTTATACAAGCATGG + Intergenic
1031627732 7:124009627-124009649 TTCTGCAGGCTGTACAGGCATGG - Intergenic
1032446519 7:131988709-131988731 TTCTGCAGTCTGTATAAGCATGG - Intergenic
1032810298 7:135407197-135407219 TTCTGCAGGCTGTACAAGCATGG - Intronic
1033027768 7:137792874-137792896 TTCTGCAGGCCATGCAAGCATGG - Intronic
1033116912 7:138633545-138633567 TTCTGCAGACTGTACAATCACGG - Intronic
1033711395 7:143950250-143950272 TTCTGCAGGCTTTACAAACATGG + Intergenic
1033723203 7:144084159-144084181 TTCTGGAGGGAATGCATGCAAGG - Intergenic
1034442420 7:151092800-151092822 TTATTCAGCCCATACATGCAAGG - Intronic
1035180521 7:157086061-157086083 TTCTGCAGGCTGTACAGGACGGG - Intergenic
1036510117 8:9392289-9392311 TTCTGCAGTCTGTACAAGCTTGG - Intergenic
1036617449 8:10399587-10399609 TTCTGCTGGCTATATAAGCATGG - Intronic
1036935424 8:12997435-12997457 TTCTACAGGCTGTACAAGCATGG - Intronic
1037068075 8:14608361-14608383 TTCTGCAGGCTGCACAAGCATGG + Intronic
1037098685 8:15016762-15016784 TTCTGCAGGCTGTATAAGCATGG + Intronic
1037147654 8:15592653-15592675 TTCTGCAAGCTGTACAAGCATGG - Intronic
1037185859 8:16063023-16063045 TTCTGCAGGCTGTAAAAGCATGG + Intergenic
1037366249 8:18125261-18125283 TTCTGCAGGCTGTGCAAGCATGG + Intergenic
1037389388 8:18377629-18377651 TTCTGCAGGCTACACAAGCATGG + Intergenic
1037586710 8:20281784-20281806 TTCTGCTGGTTGTACAAGCATGG - Intronic
1037605237 8:20432896-20432918 TTCTGCAGGCTGTACAGGCATGG + Intergenic
1037647677 8:20808239-20808261 TTTTGTAGGCTGTACAAGCATGG - Intergenic
1037650445 8:20833289-20833311 TTCTGCAGGCTATACAAGCATGG + Intergenic
1037970661 8:23169445-23169467 TCCTGTAGGCTGTACAAGCACGG - Intergenic
1038355048 8:26821272-26821294 TGCTGCAGGCTGTACAAACATGG + Intronic
1038412226 8:27367654-27367676 TTCTGCAGGCTGTGCAAGCATGG + Intronic
1038698395 8:29826802-29826824 TTCTGCAGGTTCAACATGAAAGG + Intergenic
1038739990 8:30208634-30208656 TTCTGCAGGCTGTACAAGTACGG - Intergenic
1038747270 8:30265486-30265508 TTCTGCGGGCTGTATAAGCATGG - Intergenic
1039167518 8:34701299-34701321 TTCTGCAGGCTGTACAAGGATGG - Intergenic
1039185595 8:34912339-34912361 TCCTGCAGGCTGTACAAGCAAGG + Intergenic
1039671443 8:39604712-39604734 TTCTGCAGGCTCTACAGGCATGG - Intronic
1039802974 8:40975858-40975880 TTCTGCATGCTGTACAAGCATGG + Intergenic
1039944872 8:42120446-42120468 TTCTGCAGCCTAAATATGCTGGG - Intergenic
1039948410 8:42149616-42149638 TTCTGTAGGCTATGCAAGCGTGG - Intergenic
1040013359 8:42680549-42680571 TTCTGCGGGTTGTACAAGCATGG - Intergenic
1040365285 8:46709086-46709108 TTCTGCAGGCTGTACGAGCATGG - Intergenic
1040459768 8:47635962-47635984 TTGTGAATGCTATACAGGCATGG + Intronic
1040699596 8:50045257-50045279 TTCTGCAGGTTGTACAAGCATGG + Intronic
1040984789 8:53281554-53281576 TTCTGCAGGCTGTACAAGTATGG - Intergenic
1041185658 8:55298404-55298426 CTCTGCAGGCTCTACAAGCATGG + Intronic
1041223326 8:55673545-55673567 TTCTGCAGGCTGCATAAGCATGG + Intergenic
1041265616 8:56061288-56061310 TTCTGCAGGCTATACCAGCATGG - Intergenic
1041483904 8:58353172-58353194 TTCTGCAGGCTGTATAAGCATGG + Intergenic
1041499477 8:58524483-58524505 TTCTGCAGGTTGTACAAGCATGG - Intergenic
1041522185 8:58769038-58769060 TTCCACAGGCTGTACAAGCATGG + Intergenic
1041598815 8:59690650-59690672 TTCTGCAGGCTGTACAAGCATGG - Intergenic
1041869531 8:62617147-62617169 TTCTGCAGGCTGTAGAAGCATGG - Intronic
1041872589 8:62651944-62651966 TTCTGCAGGCTGTACAAGCATGG - Intronic
1042032217 8:64488921-64488943 TTCTGCAGGCTACAGATGCATGG + Intergenic
1042033718 8:64506973-64506995 TTCTGCAGACTATACAAGCATGG - Intergenic
1042882217 8:73506058-73506080 TTCTGCAGGCTATACAGCAAGGG - Intronic
1043274156 8:78372569-78372591 TTCTGCAGGCTGTGCAATCATGG + Intergenic
1043334370 8:79155765-79155787 TTCTCCAGGCTGTACAAGAATGG - Intergenic
1043533756 8:81177492-81177514 TTTTTCAGGCTGTACAAGCATGG + Intergenic
1043617075 8:82138975-82138997 TTCTGAAGGCTGTACAAGCATGG - Intergenic
1043639637 8:82435614-82435636 TTCTGCAGGCTGTACAAGCATGG - Intergenic
1043881890 8:85553517-85553539 TTTTGCAGGCTGTACAAGCCTGG + Intergenic
1044040270 8:87358109-87358131 TTCTGCAAGTTGTACAAGCATGG - Intronic
1044130013 8:88510001-88510023 TTCTGCAGGCTGTACAAGCACGG - Intergenic
1044193834 8:89351796-89351818 TTCTGTAGGCTGTTCAAGCATGG + Intergenic
1044506844 8:93030483-93030505 TTCTGCAGGCTGTACGAGCATGG - Intergenic
1045097286 8:98811016-98811038 TTCTGCAGGTTGTACAAGCATGG - Intronic
1045158253 8:99504289-99504311 TTCTGCAGGCTGTACAAGCATGG - Intronic
1045417527 8:101982150-101982172 TTCTGAAGGGTGTACAAGCATGG - Intronic
1045436859 8:102172639-102172661 CTCTGCAGGCTGTACAAACATGG + Intergenic
1045437137 8:102174654-102174676 TTCTACAGGCTGTACAAGCATGG + Intergenic
1045536274 8:103031377-103031399 TTCTGTAGGCTGTGCAAGCATGG + Intronic
1046110776 8:109721453-109721475 TTCTGTAGGCTGTACAAGCATGG + Intergenic
1046243433 8:111528380-111528402 TTCTGGAGGTTGTACAAGCATGG + Intergenic
1046321455 8:112582319-112582341 TTCTGCAGGCTCTACAAACATGG - Intronic
1046451868 8:114403065-114403087 TTCTGCAGGCTGAACAAGCATGG - Intergenic
1046588999 8:116182831-116182853 TTCTGCAGACTATACAAGCATGG - Intergenic
1046671561 8:117062321-117062343 TTCTGCAGGCTGTCCATGCGTGG + Intronic
1047181054 8:122588462-122588484 TTCTGCAGGCTGTACATATATGG - Intergenic
1047243964 8:123121681-123121703 CTCTGCAGGCTGTGCAAGCAGGG - Intronic
1047519143 8:125581036-125581058 TTCTGCAGGCTGTGCAAGCATGG + Intergenic
1047938711 8:129806921-129806943 TTCTGCAGGCTGTATAAACATGG - Intergenic
1047997590 8:130351519-130351541 TTCTGCAGGCTGTACAAGCATGG + Intronic
1048190071 8:132280315-132280337 TTCTGCAAGCTGTACAAGCATGG + Intronic
1048202015 8:132382479-132382501 TTCTGCAGGCTGTACAAGTGTGG - Intronic
1048265008 8:132978104-132978126 TTCTGCAGGCTGTGCAAGCATGG + Intronic
1048744069 8:137593593-137593615 TTATGCAGGCTATACAAGCATGG - Intergenic
1048793648 8:138128529-138128551 TGATGGAGGGTATACATGCAAGG - Intergenic
1048838700 8:138546160-138546182 TTCTGCAGGCTCTACAAACATGG + Intergenic
1049650302 8:143763718-143763740 TTCTGCAGGCTGCACAAGCATGG - Intergenic
1049889788 9:58108-58130 TTCTGAAGGCTGTACAAGCCTGG - Intergenic
1050673458 9:8024655-8024677 TTCTGCAGGCTGTATAAGCATGG + Intergenic
1050822715 9:9901029-9901051 TTCTGCAGGCTGTACAACAATGG + Intronic
1050912007 9:11083068-11083090 TTCTGCAGGCTGTACAGGCAAGG + Intergenic
1050964702 9:11784188-11784210 TTCTGCAGGCTGTACAAGCATGG - Intergenic
1051020146 9:12533778-12533800 TTCTGCAGGCTGCACAAGTATGG + Intergenic
1051194226 9:14546171-14546193 CTCTGCAGGCTGTATAAGCATGG + Intergenic
1051194505 9:14548142-14548164 TTCTGCAGGCTGTATAAGTATGG + Intergenic
1051442226 9:17097793-17097815 TTCTGCAGGCTGTACAAGCATGG + Intergenic
1052530740 9:29681410-29681432 TTCTGCAGGCTGTGCAAACAAGG - Intergenic
1053186745 9:36022763-36022785 TTCTGCAGACTATACAAACATGG + Intergenic
1053438676 9:38095524-38095546 TTCTGCAGGCTGTACAAGCACGG - Intergenic
1053456688 9:38238466-38238488 TTCTGCAGGCTGTACAAGCATGG + Intergenic
1053731269 9:41059383-41059405 TTCTGAAGGCTGTACAAGCCTGG - Intergenic
1054697241 9:68372706-68372728 TTCTGAAGGCTGTACAAGCCTGG + Intronic
1054792456 9:69268816-69268838 TTCTGCAGGCTGTACAAGCATGG + Intergenic
1054845030 9:69785683-69785705 TTTTGCAGGCTGTACAAGCATGG - Intergenic
1054852278 9:69860214-69860236 TTCTGCAGGCTGTGCAAGCATGG + Intronic
1055147804 9:72957881-72957903 TTCTGTAGGCTGTACAAGCATGG + Intronic
1055148055 9:72959849-72959871 TTCTGCAGGCTGAACAAGCATGG + Intronic
1055180329 9:73379395-73379417 TTCTGCAGGCTGTCCAACCATGG - Intergenic
1055381599 9:75713364-75713386 TTTTGCAGGCTAGACATGTGGGG - Intergenic
1055762158 9:79620780-79620802 TTCTGTAGGCTGCACAAGCATGG + Intronic
1055813532 9:80179033-80179055 TTCTGCAGGGTGTACAGGAAGGG + Intergenic
1055976197 9:81957356-81957378 TTCTGCAGGCTATACAGGAAAGG + Intergenic
1056003933 9:82247238-82247260 TTCTGCAGGCAATACAAGCATGG - Intergenic
1056033520 9:82579541-82579563 TTCTGCAGGCTATACAAGCATGG - Intergenic
1056046405 9:82722137-82722159 GTCTGCAGGCTGTACAAGCATGG + Intergenic
1056056086 9:82825663-82825685 TTCTACAGGCTTTACAGGCAAGG + Intergenic
1056328220 9:85500034-85500056 TTCTGCAGGCTGTACAAGCATGG + Intergenic
1056362612 9:85874056-85874078 TGCTGCAGGCTATACAAGCATGG + Intergenic
1056427624 9:86492883-86492905 TTCTGCAAGCTGTACGTTCATGG - Intergenic
1056541192 9:87572728-87572750 TTCTGCAGGCCGTATAAGCATGG - Intronic
1057345890 9:94250361-94250383 TTCCTCAGGGTATACAGGCATGG + Intergenic
1057860106 9:98634203-98634225 TACTTCAGTCTATACACGCAGGG + Intronic
1058149342 9:101446903-101446925 TTCTGCAGGCTGTACAGGCATGG + Intergenic
1058177519 9:101754859-101754881 TTCTTCAGGCTGTATAAGCAGGG + Intergenic
1058724415 9:107788247-107788269 TTCTGCAAGCTGTACAAGCATGG - Intergenic
1059202602 9:112431798-112431820 TTCTGCATGCTGTACAAGCATGG - Intronic
1059688941 9:116665153-116665175 TTCTGTAGGCTGTACAAGCATGG - Intronic
1059698362 9:116749943-116749965 TTCTGCAGGCTGTACAAACATGG - Intronic
1059884967 9:118735770-118735792 TTCTGCAAGCTGTACTAGCATGG - Intergenic
1060348375 9:122836640-122836662 TTCCGCAGGTTGTACAGGCATGG + Intergenic
1060348908 9:122840316-122840338 TTCTGCAGGCTGTACAGGCATGG + Intergenic
1060774120 9:126356918-126356940 TTCTACAGCCTATACAAGCATGG - Intronic
1060890138 9:127182913-127182935 TTCTGCAAGCTTTACAAGCATGG + Intronic
1061651540 9:132054382-132054404 TTCTGCAGGCTGCACAAGCGTGG - Intronic
1062145742 9:134988729-134988751 TTCTGCAGGCTATACAAGCGTGG + Intergenic
1185600618 X:1336496-1336518 TCTTGCTGGCTATACAGGCAGGG - Intergenic
1185742587 X:2545751-2545773 TTCTGCAGACTGTACAAGCATGG - Intergenic
1186168140 X:6848846-6848868 TTCTGTAGGCTCTACAAGCATGG - Intergenic
1186300454 X:8195194-8195216 TGCTGCAGGCTGTACAAGCATGG + Intergenic
1186432113 X:9513793-9513815 TTCTACAGGCTGTACAGGCATGG + Intronic
1186687980 X:11945562-11945584 TTTTGCAGGTTATACAAGCATGG + Intergenic
1186718163 X:12275358-12275380 TTCTGTAGGCTGTACAAACATGG - Intronic
1186803283 X:13114775-13114797 TTTTGCAGGCTGTACAAGCATGG + Intergenic
1187043164 X:15618120-15618142 TTCTGCAGACTATGCAAGCATGG + Intergenic
1187083325 X:16014914-16014936 TTTTGCAGGCTGTACAAGCATGG + Intergenic
1187455661 X:19439266-19439288 TTCTGCAGACTGTACAAGCATGG - Intronic
1187834807 X:23421182-23421204 TTCTGCAGGCTGTACAAGCATGG - Intergenic
1188231163 X:27665020-27665042 TTCTGCAGCCTATAGATCAAGGG + Intronic
1188379576 X:29474547-29474569 TTCTGCATGCTGTACAAGCATGG + Intronic
1188500297 X:30818339-30818361 TTCGGTAGGCTGTACAGGCATGG - Intergenic
1188888508 X:35581265-35581287 TTCTGCAGGCTGTACAAGTATGG - Intergenic
1188997328 X:36901954-36901976 TTCTACAGGCTGTACAAGCATGG + Intergenic
1189207976 X:39258050-39258072 TTCTGCAGGCTGTATAAGCATGG - Intergenic
1189232171 X:39461035-39461057 TTCTGCAGGCTGTACACGCATGG - Intergenic
1189255460 X:39635093-39635115 GTCTGCAGGCTGTACAGGCATGG - Intergenic
1189707432 X:43772958-43772980 TTCTGCAGGCTATACAAGCATGG - Intronic
1189851180 X:45177600-45177622 TTCTGCAAGCTGTAGAAGCATGG - Intronic
1189860005 X:45262336-45262358 TTCTGCAGGCTGTACAAGCATGG + Intergenic
1189916988 X:45865014-45865036 TTCTGCAGGCTGTATAAGCATGG - Intergenic
1190479327 X:50860153-50860175 TTCTGCAGGCTGTAAAATCATGG - Intergenic
1190517727 X:51242434-51242456 TTCTGCAGGCTGTACAAGCATGG + Intergenic
1190539620 X:51463743-51463765 TTCTGCAGGCTACACAAGCATGG + Intergenic
1191201652 X:57789290-57789312 TACTGCTGGGTATATATGCAAGG + Intergenic
1191914743 X:66189335-66189357 TTTTGCAGGCTATTCTTTCAGGG - Intronic
1192276474 X:69636361-69636383 TTCTACTGGCTGTACAAGCATGG - Intronic
1192399483 X:70820514-70820536 TTCTGCAGGCTGTACAAGAATGG + Intronic
1192512042 X:71726835-71726857 TTCTGCAGGCTGTACGGGAAGGG - Intergenic
1192514655 X:71754670-71754692 TTCTGCAGGCTGTACGGGAAGGG + Intergenic
1192626207 X:72731163-72731185 TTCTGCAGGCTGTACAAGCATGG - Intergenic
1192960145 X:76121439-76121461 TTCTGCAGGCTGTTCAAGCATGG - Intergenic
1193013496 X:76705929-76705951 TTCTGCAGGTTGTACAAGCATGG + Intergenic
1193134613 X:77956659-77956681 TTCTGCAGGCTGTACAAGTATGG - Intronic
1193428445 X:81369967-81369989 TTCTGGAGGCTGTAAATACAAGG + Intergenic
1193443052 X:81566278-81566300 TTCTGTAGGCTGTACAAACATGG - Intergenic
1193553686 X:82929259-82929281 TTCTGCAGGCTATGGATACCTGG + Intergenic
1193810209 X:86042371-86042393 TTCTGCAGGCTGTACAAGCATGG + Intronic
1194019369 X:88668145-88668167 TTCTGCAGGATGTACAACCATGG + Intergenic
1194473311 X:94325511-94325533 TTCTGTAGGCTGTACAAGCATGG + Intergenic
1194475063 X:94348355-94348377 TTCTGCAGGCTGTACAAGCATGG + Intergenic
1195289674 X:103420124-103420146 TTCTGCAGGCTGTACAAGCATGG + Intergenic
1195443115 X:104920643-104920665 TTCCGCAGGGTGTACAAGCATGG - Intronic
1195659446 X:107363651-107363673 TTCTGCAGGCTGTACAAGCATGG + Intergenic
1195815807 X:108885972-108885994 TTCTGCAGGCTCTACAAGGATGG - Intergenic
1196023095 X:111010739-111010761 TTCCGCAGGCTGTACAAGCATGG - Intronic
1196170564 X:112583943-112583965 TTCTGCAGACTGTACAAACATGG + Intergenic
1196256352 X:113523684-113523706 ATCAGTTGGCTATACATGCATGG + Intergenic
1196513973 X:116547877-116547899 TTCTGAAGGCTGTACAAGCATGG - Intergenic
1196541380 X:116912379-116912401 TTCTGCAAGCTGTACAAGCATGG - Intergenic
1196777487 X:119352779-119352801 TTCTGCAGGCTGTACAGGCATGG + Intergenic
1196835907 X:119813504-119813526 TTCTGCAGGCTGTACAAGTCGGG - Intergenic
1196836843 X:119821265-119821287 TTCTGCAGGCTGTACAAGCATGG - Intergenic
1197031209 X:121818366-121818388 TTCTGCAGGCTGTACACATATGG + Intergenic
1197308816 X:124878653-124878675 TTCTTCAGGCTGTACATGCATGG - Intronic
1197357942 X:125459569-125459591 TTTTGCAGGCTGTACAAGCATGG - Intergenic
1197674379 X:129313852-129313874 TTCTGTACGCTGTACAAGCATGG + Intergenic
1197813793 X:130476089-130476111 TTCTGCAGGCTGTACAAGCATGG + Intergenic
1198093578 X:133355959-133355981 TTCTGCAGTTTGTACAAGCATGG - Intronic
1198189697 X:134289672-134289694 TTCTGCACGCTGTACAAACATGG + Intergenic
1198599998 X:138272235-138272257 TTCTTCAGGCTATACAAGCATGG + Intergenic
1199019935 X:142867289-142867311 TTCTGCAGGTTGTACAAGCATGG - Intergenic
1199071373 X:143479402-143479424 TTCTGCAGGCTGTACAAGGATGG + Intergenic
1199109358 X:143911694-143911716 TTCTGCAGGCCGTACAAGCAGGG + Intergenic
1199131753 X:144197148-144197170 TTCTGCAGGTTGTACAAGCATGG + Intergenic
1199290027 X:146094858-146094880 TTTGGCAGGCTGTACAAGCATGG + Intergenic
1199761652 X:150909178-150909200 CTCTGCAGGCTGTACAAGCATGG + Intergenic
1199785084 X:151098113-151098135 TTCTGCAGGCTGCACAAGCATGG - Intergenic
1200331885 X:155306609-155306631 TTCTGCTGGCTGTACAAACATGG + Intronic
1201125946 Y:10914365-10914387 TTCTCTAGGCTCTGCATGCAAGG - Intergenic
1201126312 Y:10917913-10917935 TTCTGTAGGCTGTACTTTCAGGG + Intergenic
1201543957 Y:15140166-15140188 TTCGTCAGGCTATACAAACATGG + Intergenic