ID: 933611839

View in Genome Browser
Species Human (GRCh38)
Location 2:84444527-84444549
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 649
Summary {0: 5, 1: 5, 2: 257, 3: 114, 4: 268}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900016585 1:154783-154805 AGATCACAGGACCACAGGACTGG - Intergenic
900046846 1:513375-513397 AGATCACAGGACCACAGGACCGG - Intergenic
900069051 1:755093-755115 AGATCACAGGACCACAGGACCGG - Intergenic
900875784 1:5341610-5341632 GCACTACAGGAGCACAGGGCTGG - Intergenic
901250196 1:7771789-7771811 GGCCCACAGGGGCTCAGGACAGG - Intronic
901680058 1:10907901-10907923 GGACCCCAGACCCAGAGGACTGG + Intergenic
902059787 1:13632426-13632448 AGATCACAGGACCACAGGACCGG + Intergenic
902964585 1:19990405-19990427 AGATCACAGGACCACAGGACGGG - Intergenic
903565789 1:24264690-24264712 GGACCACAGCCCCACGGGATAGG - Intergenic
903687618 1:25143415-25143437 GGTCCACAGGCCCATCGGACTGG - Intergenic
903772102 1:25770417-25770439 GGACCAAGGGACCAAAAGACAGG - Intronic
904013782 1:27405362-27405384 GGGCCCCAGGGCCACAGGAATGG + Exonic
904746356 1:32713588-32713610 CGACCATAGGACCACAGGGAGGG - Intergenic
906064829 1:42973082-42973104 GGATTACAGGGCCAAAGGACAGG + Intergenic
906249203 1:44298338-44298360 AGACCACATGGCCAAAGGACTGG + Intronic
907506707 1:54924332-54924354 AGATCACAGGACCACAGGACCGG + Intergenic
907622540 1:55996086-55996108 AGATCACAGGACCACAGGACCGG + Intergenic
908019750 1:59887447-59887469 AGATCACAGGACCACAGGACTGG - Intergenic
908045274 1:60161817-60161839 AGATCACAGGACCACAGGACCGG + Intergenic
908186675 1:61658990-61659012 AGACCACAGGACCCCAAGGCTGG + Intergenic
909136359 1:71805225-71805247 AGATCACAGGACCACAGGATGGG - Intronic
909173334 1:72322384-72322406 GGCCCAAAGGGCCACAGGATTGG - Intergenic
909254939 1:73408075-73408097 AGATCACAGGACCACAGGACTGG - Intergenic
909464822 1:75961393-75961415 AGATCACAGGACCACAGGACTGG - Intergenic
909556540 1:76960417-76960439 AGATCACAGGACCACAGGACGGG + Intronic
911083034 1:93951975-93951997 AGATCACAGGACCACAGGACTGG + Intergenic
911940778 1:104044817-104044839 AGATCACAGGACCACGGGACCGG + Intergenic
912114962 1:106394532-106394554 GGACCACAGGACACAAGGTCAGG - Intergenic
912303480 1:108540721-108540743 AGATCACAGGACCACAGGACCGG - Intergenic
912584526 1:110750291-110750313 GGGCCCCTGGACCACAGCACAGG + Intergenic
912807181 1:112766394-112766416 AGATCACAGGACCACAGGACTGG - Intergenic
913024605 1:114824495-114824517 AGATCACAGGACCACAGGACTGG - Intergenic
915146937 1:153800892-153800914 GAACCACAGGCCCAGAGGCCTGG - Intergenic
915676552 1:157537515-157537537 AGCTCACAGGACCACAGGACCGG - Intronic
916290312 1:163158710-163158732 GGACCACAGGACCACAGGACCGG + Intronic
916626897 1:166567791-166567813 AGATCACAGGACCACAGGACTGG + Intergenic
919189972 1:194203794-194203816 AGATCACGGGACCACAGGACAGG + Intergenic
919967227 1:202539889-202539911 TGACCACAGGTTCTCAGGACTGG - Intronic
922104410 1:222500486-222500508 AGATCACAGGACCACAGGACCGG - Intergenic
922376246 1:224970385-224970407 ACATCACAGGACCACAGGACCGG - Intronic
922694630 1:227723032-227723054 AGATCACAGGACCACAGGACTGG - Intergenic
922788897 1:228298899-228298921 GGCCCACAGTATCACAGGAGAGG - Intronic
923658236 1:235937005-235937027 GGACTACAGGCTCACAGCACAGG - Intergenic
923716840 1:236432250-236432272 GGACCATGGGACCACAGGTGTGG - Intronic
924120203 1:240789782-240789804 AGATCACAGGACCACAGGACCGG - Intronic
924346586 1:243078004-243078026 AGATCACAGGACCACAGGACTGG - Intergenic
924490003 1:244527037-244527059 AGATCACAGGACCACAGGACCGG + Intronic
924869637 1:248027357-248027379 AGATCACGGGACCACAGGACTGG - Intronic
1062907109 10:1186596-1186618 GCACCACAGGACAGCAGGCCAGG - Intronic
1062961472 10:1576203-1576225 GGAGCTCAGGGTCACAGGACAGG + Intronic
1063167526 10:3477261-3477283 TGACCACAGGGCCCCAGGACAGG + Intergenic
1064893638 10:20209035-20209057 GGACCACAGGACCACAGGACGGG + Intronic
1065053401 10:21818424-21818446 AGATCACAGGACCACAGGACTGG - Intronic
1066653496 10:37680410-37680432 GGGACACGGGAGCACAGGACTGG - Intergenic
1066698459 10:38100223-38100245 AGATCACAGGACCGCAGGACCGG + Intronic
1066729762 10:38426845-38426867 AGATCACAGGACCACAGGACCGG + Intergenic
1067850637 10:49751716-49751738 GTACCACAGGAAGGCAGGACTGG - Intronic
1068290835 10:55000015-55000037 AGATCACAGGACCACAGGACAGG + Intronic
1068515648 10:58022185-58022207 AGATCACAGGACCACAGGACCGG - Intergenic
1068662567 10:59637621-59637643 AGATCACAGGACCACAGGACGGG + Intergenic
1069737731 10:70668501-70668523 AGATCACAGGACCACAGGACCGG - Intergenic
1070050340 10:72882704-72882726 AGATCACAGGACCACAGGACCGG - Intronic
1071588983 10:86853838-86853860 AGATCACAGGACCACAGGACGGG + Intronic
1071945463 10:90638895-90638917 AGATCACAGGACCACAGGACTGG - Intergenic
1073678606 10:105677944-105677966 AGATCACAGGACCACAGGACTGG - Intergenic
1074983808 10:118640304-118640326 AGATCACAGGACCACAGGACCGG + Intergenic
1075997625 10:126891399-126891421 AGATCGCAGGACCACAGGACTGG - Intergenic
1076342099 10:129756282-129756304 GGTACCCAGCACCACAGGACAGG + Intronic
1076973175 11:149852-149874 AGATCACAGGACCACAGGACTGG - Intergenic
1077042295 11:530155-530177 ACACCCCAGGACCACAGCACAGG + Intergenic
1077347845 11:2072519-2072541 GGACCACAGGAGCAAGGGTCGGG + Intergenic
1077898564 11:6473003-6473025 GGACAACAGAAACTCAGGACTGG - Intronic
1078797895 11:14611670-14611692 GGATCCCAGGACCACAGAATTGG + Intronic
1078857356 11:15217124-15217146 GGCTCACAGTTCCACAGGACTGG + Intronic
1079272642 11:19003153-19003175 AGATCACAGGACCACAAGACCGG + Intergenic
1081009906 11:37798050-37798072 AGATCACAGGACCACAGGACCGG + Intergenic
1081167144 11:39820387-39820409 CCACCACAGGACCAGAGGCCTGG - Intergenic
1081254097 11:40871210-40871232 AGATCACAGGACCACAGGACAGG - Intronic
1081678576 11:44985949-44985971 GGAGGCCAGGACCACAGGATAGG - Intergenic
1081732078 11:45378704-45378726 GGACTGCAGCAGCACAGGACTGG + Intergenic
1082662074 11:55924197-55924219 AGATCACAGGACCACAGGACTGG + Intergenic
1082780276 11:57282063-57282085 AGATCACAGGACCACAGGATGGG + Intergenic
1082788110 11:57328470-57328492 GGACCCCACGGCCTCAGGACAGG + Intronic
1082919212 11:58474016-58474038 AGATCACAGGACCACAGGACCGG - Intergenic
1083039038 11:59668787-59668809 GCCCCGCAGGAACACAGGACCGG + Intronic
1083092784 11:60218303-60218325 AGATCACAGGACCACAGTACCGG - Intronic
1083140163 11:60714979-60715001 GGAGGACAGGAGCACGGGACTGG - Intronic
1083311357 11:61785532-61785554 GGAACCCAGCACAACAGGACTGG + Intronic
1083520947 11:63312435-63312457 AGATCACAGGACCACAAGACGGG + Intronic
1084097996 11:66925125-66925147 AGATCACAGGACCACAGGACCGG + Intronic
1084422242 11:69066227-69066249 GGACGGCAGGACCACAGCACTGG - Intronic
1084828684 11:71751338-71751360 AGATCACAGGACCACAGGACCGG - Intergenic
1085048962 11:73369882-73369904 GGTCCTCAACACCACAGGACGGG + Intergenic
1085317304 11:75553362-75553384 GCATCACAGGTCCACAGGACTGG - Intergenic
1086757027 11:90577660-90577682 GGAACACATGAACACAGGAAAGG - Intergenic
1089858663 11:121569720-121569742 AGATCACAGGACCACAGGACGGG - Intronic
1090081114 11:123613425-123613447 AGACAAAAGGACCACAGGAGAGG - Intronic
1090222892 11:125046052-125046074 AGATCACAGGACCACAGGACTGG - Intergenic
1090332287 11:125941641-125941663 GGACAACAGGGACAGAGGACAGG - Intergenic
1090646929 11:128773839-128773861 GGATCACAGGAACACAGGTTTGG + Intronic
1090845638 11:130527788-130527810 GGACCACAGGCCCCCAGGGAAGG - Intergenic
1091112877 11:132987002-132987024 GGAGCACAGGACTTCAAGACGGG + Intronic
1091593584 12:1859886-1859908 GGCCCACAGGAGCATAGCACAGG + Intronic
1092678173 12:10945579-10945601 AGATCACAGGACCACAAGACCGG + Intronic
1092914856 12:13180427-13180449 AGATCACAGGACCACAGGACCGG + Intergenic
1092951465 12:13507471-13507493 GGACCAAGGAACCACAGGAGGGG + Intergenic
1093074713 12:14745934-14745956 AGATCACAGGACCACAGGACTGG + Intergenic
1094411762 12:30174419-30174441 AGATCACAGGACCACAGGACTGG - Intergenic
1094416594 12:30222719-30222741 AGATCACAGGACCACAGGACTGG - Intergenic
1095087173 12:38069566-38069588 AGATCACAAGACCACAGGACCGG - Intergenic
1095172748 12:39055048-39055070 AGATCACAGGACCACAGGACCGG - Intergenic
1095363467 12:41373185-41373207 AGATCACAGGACCACAGGACCGG + Intronic
1095941550 12:47730498-47730520 TGATGACAGGACAACAGGACTGG + Intergenic
1097575524 12:61388549-61388571 GACTCACAGTACCACAGGACTGG + Intergenic
1098459366 12:70715352-70715374 AGACCACAGGACTACAGGACCGG + Intronic
1098599614 12:72315656-72315678 TGGCCACAGGAGCCCAGGACTGG + Intronic
1098781143 12:74687889-74687911 AGATCACAGGACCACAGGACCGG + Intergenic
1099117774 12:78648994-78649016 AGATCACAGGACCACAGGACTGG - Intergenic
1099721302 12:86364880-86364902 AGATCACAGGACCACAGGACTGG + Intronic
1100499125 12:95156565-95156587 AGATCACAGGACCACAGGACGGG - Intronic
1100606375 12:96155118-96155140 GGAGTCCAGGACCACAGCACTGG - Intergenic
1100607233 12:96161875-96161897 GACCCAGAGGACCACAGGAATGG - Intergenic
1102583775 12:113909030-113909052 GGACTGCAGGACCGCAGGACAGG + Intronic
1103811411 12:123617011-123617033 GGACTACAGGAACACACGCCTGG - Intronic
1104693223 12:130842208-130842230 AGATCACAGGACCACAGGACCGG - Intergenic
1104772921 12:131375532-131375554 AGACGACAGCAGCACAGGACGGG - Intergenic
1104878217 12:132051502-132051524 GGATCACATGGCCACTGGACAGG + Intronic
1104929341 12:132329719-132329741 GGACCCCAGGACAGCAGGTCCGG + Intergenic
1105026197 12:132850704-132850726 AGCACACAGGACCACAGCACTGG - Intronic
1105227640 13:18451291-18451313 AGATCACAGGACCACAGGACCGG + Intergenic
1106254853 13:28012798-28012820 GGACCACAGGCACACACCACCGG - Intronic
1106961037 13:34998294-34998316 AGATCACAGGACCACAGGACTGG + Intronic
1108294659 13:49001834-49001856 AGATCACAGGACCACAGGACTGG - Intronic
1109424386 13:62151966-62151988 AGATCACAGGACCACAGGACTGG - Intergenic
1109846928 13:68005449-68005471 TGACCACAGAACCACAACACGGG - Intergenic
1111468274 13:88645113-88645135 AGATCACAGGACTACAGGACCGG + Intergenic
1111509596 13:89243312-89243334 AGATCACAGGACCACAGGACCGG - Intergenic
1111712108 13:91829916-91829938 AGATCACAGGACCACAGGACTGG + Intronic
1112034666 13:95485980-95486002 GGATCACTGGACCACAGCATTGG - Intronic
1112960553 13:105120306-105120328 AGATCACAGGACCACACGACTGG + Intergenic
1113290565 13:108901174-108901196 AGATCACAGGACCACAGGACTGG - Intronic
1114144282 14:19955398-19955420 AGATCACAGGACGACAGGACTGG - Intergenic
1114355557 14:21904085-21904107 AGATCACAGGACCACAGGACTGG - Intergenic
1114892409 14:26942148-26942170 AGATCACAGGACCACAGGACTGG + Intergenic
1115884719 14:37958567-37958589 AGATCACAGGACCACAGGACCGG - Intronic
1116501982 14:45634604-45634626 GAACCACAGGAGCCCAGGGCAGG - Intergenic
1116562766 14:46402398-46402420 AGATCACAGGACCACAGGACCGG - Intergenic
1118376153 14:65178931-65178953 AGATCACAGGACCACAGGACGGG + Intergenic
1119959823 14:78842502-78842524 AGATCACAGGACCACAGGACTGG + Intronic
1121004854 14:90483692-90483714 GCACCACAGGAACCCAGGAAAGG - Intergenic
1121477999 14:94230718-94230740 GGAGCACAGGGACACAGGTCAGG + Exonic
1122087166 14:99316118-99316140 CGTCCTCAGGTCCACAGGACAGG + Intergenic
1122537118 14:102473160-102473182 GGACCTCAGAGCCACAGGAGAGG - Intronic
1123093237 14:105751383-105751405 GCACCACGGGGCCACAGGAGTGG - Intergenic
1123664291 15:22595939-22595961 AGATCACAGGACCACAGGACCGG - Intergenic
1123690348 15:22833453-22833475 AGATCACAGGACCACAGGACGGG + Intergenic
1123845545 15:24297443-24297465 AGATCACAGGACCACAGGACTGG + Intergenic
1123864587 15:24505233-24505255 AGATCACAGGACCACAGGACTGG + Intergenic
1123868093 15:24542480-24542502 AGATCACAGGACCACAGGACTGG + Intergenic
1124318125 15:28690375-28690397 AGATCACAAGACCACAGGACCGG - Intergenic
1124565312 15:30807110-30807132 AGATCACAGGACCACAGGACTGG + Intergenic
1124601076 15:31133294-31133316 GGACTACAGGAACACACCACTGG - Intronic
1125407722 15:39370536-39370558 AGATCACAGGACCACAGGACCGG + Intergenic
1125567306 15:40686356-40686378 AGATCACAGGACCACAGGACTGG + Intergenic
1127072280 15:55298529-55298551 AGATCACAGGACCACAGGACTGG + Intronic
1127295778 15:57607601-57607623 GGCCCTGAGGAGCACAGGACAGG + Intronic
1127755088 15:62084351-62084373 AGATCACAGGACCACAGGACTGG + Intergenic
1127963743 15:63908692-63908714 GGACCACGGGACTACAAGCCAGG + Intronic
1128252991 15:66176788-66176810 GGGCCAGATGACCACAGGATAGG + Intronic
1128954507 15:71926232-71926254 GCCCCCCAGGACCAGAGGACTGG - Intronic
1129218743 15:74118349-74118371 AGATCACAGGACCACAGGACCGG + Intronic
1129250247 15:74304746-74304768 GGAAGACAGGCCCACCGGACTGG - Intronic
1129468529 15:75737855-75737877 GGCCCACAGGAGCAGAGGCCAGG - Intergenic
1129514301 15:76147689-76147711 GGACCCCAGGACTACAGGAAAGG - Intronic
1129727051 15:77906652-77906674 GGCCCACAGGAGCAGAGGCCAGG + Intergenic
1129969148 15:79762035-79762057 AGATCACAGGACCACAGGACCGG + Intergenic
1130306744 15:82716965-82716987 AGATCACAGGACTACAGGACCGG - Intergenic
1130757277 15:86778247-86778269 AGATCACAGGACCATGGGACTGG + Intronic
1131312206 15:91301065-91301087 TAGCCATAGGACCACAGGACTGG - Exonic
1131382678 15:91976890-91976912 AGATCACAGGACCACAGGACCGG + Intronic
1131589709 15:93735366-93735388 AGATCACAGGACCACAGGACTGG - Intergenic
1131761651 15:95629506-95629528 GCACAACAGGTACACAGGACAGG - Intergenic
1132213735 15:100047281-100047303 AGATCACAGGACCACAGGACCGG - Intronic
1132226585 15:100146998-100147020 AGATCACAGGACCACAGGACCGG - Intronic
1132694558 16:1196098-1196120 GGCCCCCAGGAGCACAGGACTGG + Intronic
1132748298 16:1445989-1446011 GGTACACAGGCCCAGAGGACTGG - Exonic
1133061521 16:3177858-3177880 GCTCCTCAGGACCACAGGAACGG + Intergenic
1133162086 16:3918799-3918821 AGATCACAGGACTACAGGATCGG - Intergenic
1135301158 16:21328650-21328672 AGATCACAGGACCACAGGACTGG - Intergenic
1136451319 16:30355724-30355746 TGACCACTGGACCATAGGAATGG - Intergenic
1136595405 16:31245647-31245669 AGATCACAGGACCACAGGACTGG + Intergenic
1136598192 16:31266018-31266040 GGACCACAGGCCTAGGGGACAGG - Exonic
1136635284 16:31517506-31517528 AGATCACAGGACCACAGGACTGG - Intergenic
1137613404 16:49833919-49833941 AGGCCACTGGACCACAGAACTGG + Intronic
1137631190 16:49946739-49946761 TGAAGACAGGACCTCAGGACAGG + Intergenic
1138408073 16:56814807-56814829 GGACGACAGGACAAGATGACAGG - Intronic
1138767503 16:59622219-59622241 AGATCACAGGACCATAGCACTGG + Intergenic
1139000858 16:62508195-62508217 AGATCACAGGACCACAGGACAGG + Intergenic
1139497973 16:67335016-67335038 AGATCACAGGACCACAGGACCGG + Intronic
1139961742 16:70721928-70721950 GGAGCACAGGACCCCAGGCCCGG + Intronic
1141724399 16:85777590-85777612 GAACCACAGGTGCACAGCACTGG + Intronic
1142124826 16:88405051-88405073 GAACCACATGAACACAGGGCAGG + Intergenic
1142268113 16:89074329-89074351 AGACGACAGGACCACACGACAGG - Intergenic
1142268124 16:89074417-89074439 AGATGACAGGACCACACGACAGG - Intergenic
1142268141 16:89074564-89074586 AGACGACAGGACCACACGACAGG - Intergenic
1142268153 16:89074666-89074688 AGACGACAGGACCACACGACAGG - Intergenic
1142268172 16:89074828-89074850 AGACGACAGGACCACACGACAGG - Intergenic
1142268184 16:89074930-89074952 AGATGACAGGACCACACGACAGG - Intergenic
1142268197 16:89075047-89075069 AGACGACAGGACCACACAACAGG - Intergenic
1142447075 16:90147674-90147696 AGATCACAGGACCACAGGACCGG + Intergenic
1142460417 17:87657-87679 AGATCACAGGACCACAGGACCGG - Intergenic
1146006886 17:29166178-29166200 GGACCACACGCCGACAGGCCTGG + Exonic
1147218502 17:38914620-38914642 GGACCAGAGGACCTGAGGCCGGG + Intronic
1147591408 17:41686099-41686121 AGACCACAGGACCACAGGACCGG - Intergenic
1147764464 17:42824336-42824358 GGTCCACAGGCTCACAGGCCCGG + Intronic
1147840177 17:43365888-43365910 AGATCACAGGACCACAGGACTGG + Intergenic
1147925007 17:43940778-43940800 GGTCCACAGAGACACAGGACAGG + Intergenic
1150358829 17:64511141-64511163 AGATCACAGGACCACCTGACTGG + Intronic
1150777762 17:68095372-68095394 GGGCCACAGCACAACAGGGCTGG + Intergenic
1151690366 17:75680400-75680422 GGACCACAAGTCCACCAGACCGG - Intronic
1151883304 17:76907949-76907971 AGACGAAAGAACCACAGGACAGG - Intronic
1151959402 17:77397633-77397655 GGATCACAGGATCACAGGATAGG - Intronic
1152184367 17:78844794-78844816 GTGCCACAGGGCCACAGGAAGGG - Intergenic
1152187793 17:78869042-78869064 GAACCACAGGAGGCCAGGACAGG - Intronic
1152199204 17:78935328-78935350 GAACCACAGTCCCACAGGACAGG - Intergenic
1152244326 17:79177272-79177294 TGTCCCCAGGACCAGAGGACAGG + Intronic
1153606713 18:6841091-6841113 GGACCCCAGAGACACAGGACAGG - Intronic
1154047656 18:10922040-10922062 AGATCACAGGACCACAGGACCGG - Intronic
1154525742 18:15288185-15288207 AGATCACAGGACCACAGGACCGG - Intergenic
1155506158 18:26535360-26535382 GAACCACAGAAACAGAGGACTGG + Intronic
1155854531 18:30816250-30816272 AGATCACAGGACCACAGGACCGG - Intergenic
1156761434 18:40596298-40596320 AGATCACAGGACCACAGGACCGG + Intergenic
1158113038 18:53963027-53963049 AGATCACAGGACCACAGGGCTGG - Intergenic
1159686213 18:71424042-71424064 AGATCACAGGACCACAGGACTGG - Intergenic
1160435344 18:78847816-78847838 AGGCCACAGGACCAAAGGATCGG + Intergenic
1160650132 19:220157-220179 AGATCACAGGACCACAGGACCGG - Intergenic
1160660345 19:295251-295273 GAGCCACAGGACCAGGGGACGGG + Intergenic
1160742421 19:693362-693384 GGACCACAGAAGCACAGCTCCGG + Intronic
1160838407 19:1135583-1135605 GGGCCACGGGAGCCCAGGACTGG - Intronic
1161003559 19:1923401-1923423 GGCCCAGGGGGCCACAGGACTGG - Intronic
1161305782 19:3566814-3566836 GTACCACAGTACCACAGTACTGG - Intronic
1161683759 19:5693239-5693261 GGCCCACACCACCACGGGACAGG - Intronic
1163235925 19:16030563-16030585 GGAACACAGCACCACAGGGAGGG + Intergenic
1164339339 19:24372162-24372184 GGATCACAGAACCACAGGACCGG - Intergenic
1164365673 19:27579439-27579461 AAATCACAGGACCACAGGACTGG - Intergenic
1164549596 19:29198128-29198150 GGACCACAGGACCACAGGACTGG + Intergenic
1165852785 19:38859981-38860003 GGAGCACAGCACCACAGGGAGGG + Intergenic
1166140346 19:40802085-40802107 GGACGACAGGAGCACAGGGAAGG - Intronic
1166165932 19:40988669-40988691 AGATCACAGGACCACAGGACCGG - Intergenic
1166222571 19:41375172-41375194 GGGCCACAGGAACACAGCCCGGG + Intronic
1166745103 19:45138179-45138201 GGAGCCCAGGAGGACAGGACTGG - Intronic
1167642300 19:50688453-50688475 GGACCTCAGGCACACAGCACCGG + Intronic
1168098429 19:54128450-54128472 GGGCCACAGGACGAGAGGAGGGG - Intronic
1202635861 1_KI270706v1_random:43563-43585 GGAACACAGGGACACAGGAAGGG + Intergenic
926556298 2:14362178-14362200 AGATCACAGGACCACAGGACCGG + Intergenic
926680547 2:15660586-15660608 GGAGCACAGGGCCCCAAGACAGG - Intergenic
926859096 2:17290288-17290310 AGATCACAGGACCACAGGACCGG + Intergenic
926874158 2:17456760-17456782 AGATCACAGGACCACAGGACCGG + Intergenic
927195712 2:20545042-20545064 AGATCACAGGACCACAGGACCGG + Intergenic
927615121 2:24586312-24586334 GGACCACAGGCGCACATCACCGG - Intronic
927757005 2:25716764-25716786 GTACCACAGGAACACAGGGCAGG - Intergenic
928708389 2:33976977-33976999 AGATCACAGGACCACAGGACCGG - Intergenic
928901592 2:36323959-36323981 AGATCACAGGACCACAGGACTGG - Intergenic
929362715 2:41113712-41113734 AGATCACAGGACCACAGGACCGG + Intergenic
929595572 2:43173583-43173605 GGGCCCCAGGACTGCAGGACAGG + Intergenic
930007478 2:46909659-46909681 GGACTGAAGGACCACAGGAATGG + Intronic
930489546 2:52050995-52051017 AGATCACAGGACCACAGGACCGG - Intergenic
932881787 2:75508589-75508611 AGATCACAGGACCACAGGACTGG - Intronic
933333115 2:80920154-80920176 AGATCATAGGACCACAGGACCGG - Intergenic
933611839 2:84444527-84444549 GGACCACAGGACCACAGGACCGG + Intronic
935171426 2:100613684-100613706 GGAGCCAAGGACCCCAGGACAGG - Intergenic
935263573 2:101375686-101375708 GGACCACCCTACCCCAGGACGGG + Intronic
935936924 2:108195945-108195967 GGACCACAGGCCCCCATGCCCGG - Intergenic
936486643 2:112931448-112931470 GGACCAAAGAACCACACGAATGG - Intergenic
936517547 2:113192010-113192032 GTACAGGAGGACCACAGGACAGG + Intronic
936686748 2:114836575-114836597 AGATCACAGGACCACAGGACTGG + Intronic
936813894 2:116435762-116435784 GACTCACAGTACCACAGGACTGG - Intergenic
936874163 2:117168094-117168116 GGATCACAGGACCACAGGACGGG + Intergenic
937040736 2:118818787-118818809 GGCCCACAGGCCCACAGACCTGG + Intergenic
937684701 2:124682537-124682559 GGACCACTGGACCACTGGACTGG + Intronic
937720972 2:125095830-125095852 GGATGACAGGACCAGAGGAGAGG + Intergenic
937952220 2:127397550-127397572 GGACCTCAGAACCACCTGACAGG + Intergenic
938027099 2:127959152-127959174 GGACCTCGGGACCCCAGGAATGG + Intronic
938308709 2:130270996-130271018 AGATCACAGGACCACAGGATCGG + Intergenic
938524841 2:132119546-132119568 AGATCACAGGACCACAGGACCGG - Intergenic
939246085 2:139625363-139625385 AGATCACAGGACCACAGGACCGG + Intergenic
940156492 2:150662166-150662188 AGATCACAAGACCACAGGACCGG + Intergenic
942478282 2:176352986-176353008 AGATCACAGGACCACAGGACTGG + Intergenic
944178638 2:196862431-196862453 AGATCACAGGACCACAGGACCGG - Intronic
944397115 2:199280810-199280832 AGATCACAGGACCACAGGACAGG - Intronic
944780097 2:203008765-203008787 AGATCACAGGACCATAGGACTGG - Intronic
945386082 2:209202777-209202799 AGATGACAGGACCACAGGACCGG + Intergenic
945488303 2:210424756-210424778 AGATCACAGGACCACAGGACCGG + Intergenic
945897236 2:215497496-215497518 AGATCACAGGACCACAGGACCGG - Intergenic
946240907 2:218355057-218355079 GGAGCACAGCACCACAGGGAGGG - Intergenic
948012884 2:234664115-234664137 AGATCACAGGACCACAGGACTGG - Intergenic
948017531 2:234702392-234702414 GGACCACAGTTCCACATGGCTGG - Intergenic
1168842910 20:921189-921211 GCAGCACAGGACCAGAGGCCTGG - Intergenic
1168930372 20:1618686-1618708 TGACCCCAGAACCACAGGGCTGG - Intronic
1169613739 20:7414320-7414342 AGATCACAGGACCACAGGACGGG + Intergenic
1171232221 20:23496514-23496536 AGATCACAGGACTACAGGACTGG + Intergenic
1171324863 20:24282441-24282463 GGGCCACAGAACAACATGACTGG + Intergenic
1171492446 20:25530823-25530845 AGATCACAGGACCACAGGACTGG + Intronic
1171969964 20:31558247-31558269 GCTCCACAGGAGCACAGGAGAGG - Intronic
1172981649 20:38947351-38947373 GGAGAATAGGAACACAGGACAGG - Intronic
1174038438 20:47682620-47682642 GGAACCCCGGACCACAGCACAGG - Intronic
1174506385 20:51020315-51020337 GGACCTCAGGACGGCAGGAAGGG + Intronic
1175766521 20:61596337-61596359 GGCTCACAGGGCCACAGGAGGGG + Intronic
1176771685 21:13080302-13080324 AGATCACAGGACCACAGGACCGG + Intergenic
1178014550 21:28328989-28329011 AGATCACAGGACCACAGGACCGG + Intergenic
1178286042 21:31326281-31326303 GGACAACAGGAAGACAGGAGAGG - Intronic
1178503310 21:33143530-33143552 GGATCACAGGATTACAGAACTGG - Intergenic
1178667309 21:34559850-34559872 GGACCACAGAATCACAGGGCAGG - Intronic
1178910335 21:36668805-36668827 GGACCACTGACCCCCAGGACAGG - Intergenic
1179453295 21:41480199-41480221 TGACCAGATGACCACAGCACTGG + Intronic
1179660957 21:42874827-42874849 AGATCGCAGGACCACAGGACCGG - Intronic
1179883067 21:44301416-44301438 GGACCCCTGGCCCACAGGAAAGG - Intronic
1180219929 21:46352121-46352143 GGCGCCCAGGTCCACAGGACAGG + Intronic
1180518811 22:16174749-16174771 AGTTCACAAGACCACAGGACCGG + Intergenic
1180698689 22:17770104-17770126 GGACAGCAGGAGAACAGGACAGG - Intronic
1180708508 22:17824182-17824204 GACCCACAGGACCACTGGCCGGG + Intronic
1181012880 22:20052653-20052675 GGGCCAAGGGACTACAGGACTGG + Intronic
1181045393 22:20211831-20211853 GGGCCAGAGGGGCACAGGACAGG + Intergenic
1181307704 22:21926488-21926510 GGACCACAACACCCCAGGCCTGG + Intronic
1181943021 22:26493489-26493511 GCAACACTGGAGCACAGGACTGG + Exonic
1181959702 22:26614148-26614170 AGATCACAGGATCACAGGACCGG - Intronic
1182243560 22:28936477-28936499 GGACCTCAGGATCCCAGGAGAGG - Intronic
1182386058 22:29942386-29942408 AGATCACAGGACCACAGGACCGG + Intronic
1182486027 22:30639355-30639377 AGATCACAGGACCATAGGACCGG + Intronic
1182894381 22:33846915-33846937 AGATCACAAGACCACAGGACAGG - Intronic
1183171323 22:36190289-36190311 AGATCACAGGAACACAGGACCGG + Exonic
1184062958 22:42095936-42095958 AGTTCACAGGACCACAGGACCGG - Intergenic
1184651428 22:45921012-45921034 GGACCACAGGGCCAGAGCCCAGG + Exonic
1185292497 22:50034241-50034263 GGCCCACAGCACCACAGGGAAGG - Intronic
949447404 3:4149769-4149791 GGACTACACGTCCACAGGCCAGG - Intronic
952784886 3:37143347-37143369 GGACAACATGGTCACAGGACTGG + Intronic
953519621 3:43628921-43628943 AGATCACAGGACCACAGGACTGG - Intronic
953994095 3:47506249-47506271 AGATCACAGGACTGCAGGACCGG + Intronic
954219248 3:49142715-49142737 AGATCACAGGACCACAGGACTGG + Intergenic
954287890 3:49631708-49631730 GGACAGCTGTACCACAGGACAGG + Intronic
954518853 3:51204968-51204990 GGAACACATGGACACAGGACGGG + Intronic
954612888 3:51955556-51955578 GGACAAGAGGAGCAGAGGACAGG + Exonic
955855934 3:63273946-63273968 GGGCCACTGGTACACAGGACAGG - Intronic
956131316 3:66056332-66056354 AGATCACAGGACCACAGGATGGG + Intergenic
956790786 3:72678560-72678582 GAACCACAGGACCAAAGTCCAGG + Intergenic
957119432 3:76070539-76070561 AGATCACAGGACCACAGGACAGG - Intronic
957121619 3:76101793-76101815 GGAACACAGGGACACAGGAAGGG - Intronic
957373479 3:79326202-79326224 AGTTCACAGGACCACAGGACCGG - Intronic
957874801 3:86131305-86131327 AGATCATAGGACCACAGGACCGG + Intergenic
957926582 3:86821944-86821966 AGATCACAGGACCACAGGACCGG + Intergenic
958080220 3:88737531-88737553 GGTAAACAGGGCCACAGGACAGG - Intergenic
958603399 3:96327902-96327924 AGATCACAGGACCACAGGCCCGG - Intergenic
958722053 3:97855873-97855895 AGATCACAGGACCACAAGACTGG + Intronic
958998968 3:100939658-100939680 AGATCACAGAACCACAGGACCGG + Intronic
959117284 3:102193298-102193320 GGGCCACAGAACCACTAGACAGG + Intronic
959118797 3:102208673-102208695 AGATCACAGGAACACAGGACTGG + Intronic
959126389 3:102294709-102294731 AGATCACAGGACCACAGGACCGG - Intronic
959470564 3:106744712-106744734 AGATCACAGGACCACAGGACCGG - Intergenic
959575282 3:107927038-107927060 GGACCACAGCACATCAGGATGGG - Intergenic
959938956 3:112060225-112060247 AGATCACAGGACCACAGGACCGG + Intronic
960374231 3:116878716-116878738 AGATCACAGGACCACAGGACTGG + Intronic
960541296 3:118865311-118865333 AGATCACAGGACCACAGGACCGG - Intergenic
961698178 3:128721124-128721146 AGATCACAGGACCACAGGACCGG - Intergenic
961837426 3:129674630-129674652 GGACTACAGAATCACAGGACAGG + Intronic
961923647 3:130452620-130452642 AGATCACAGGACCACAGGACTGG + Intronic
962290380 3:134131350-134131372 AGATCACAGGACCACAGGACCGG + Intronic
962411013 3:135141847-135141869 GGACCACAGGTCCTCAGGGAGGG + Intronic
962651575 3:137499097-137499119 AGATCACAGGACCACAGGACTGG - Intergenic
962765307 3:138556845-138556867 AGATCACAGGACCACAGACCGGG + Intronic
963176553 3:142303909-142303931 AGATCACAGGACCACAGGACCGG + Intergenic
963414940 3:144983394-144983416 AGATCACAGGACCACAGGACTGG + Intergenic
964880394 3:161417106-161417128 AGATCACAGGACCACAGGACCGG + Intergenic
964945899 3:162223104-162223126 AGATCACAGGACCACAGGACCGG - Intergenic
965400711 3:168209384-168209406 AGATCACAGGACTACAGGACCGG + Intergenic
966124876 3:176564070-176564092 AGATCACAGGACCACAGGACCGG - Intergenic
966142601 3:176772707-176772729 AGATCACAGGACCACAGGACCGG - Intergenic
966151278 3:176869679-176869701 AGATCACAGGACTACAGGACCGG + Intergenic
966613159 3:181888435-181888457 GGACTACAGGCACACAGGGCTGG - Intergenic
966817354 3:183900175-183900197 AGATCACAGGACCACAGGACTGG - Intergenic
967412757 3:189183355-189183377 AGATCACAGCACCACAGGACCGG + Intronic
967764519 3:193263887-193263909 GGACAACAGGACAACAGGTAGGG - Intronic
968212138 3:196857782-196857804 AGATCACATGACCACAGGACTGG + Intergenic
968367715 3:198199972-198199994 AGATCACAGGACCACAGGACTGG + Intergenic
968480222 4:829984-830006 GGATCCCAGGACCCCAGGGCAGG - Intergenic
968481070 4:833350-833372 GGCCCACAGCTCCACAGGCCTGG + Intergenic
968574929 4:1361207-1361229 GGACCACAGCACCACAGGCCTGG - Intronic
970016640 4:11519476-11519498 AGAACACAGGAACACAGGAAGGG - Intergenic
970342432 4:15120769-15120791 AGATCACAGGACCACAGAACCGG - Intergenic
971365845 4:25976576-25976598 AGATCACAGGACCACAGGACCGG - Intergenic
971586311 4:28409089-28409111 AGATCACAGGACCACAGGACTGG + Intergenic
972038206 4:34554012-34554034 AGATCACAGGACCACAGGACTGG + Intergenic
972242940 4:37213646-37213668 GGAGAACAGGACAACAGGAAAGG - Intergenic
974199460 4:58620331-58620353 AGGTCACAGGACCACAGGACCGG - Intergenic
974208834 4:58743246-58743268 AGATCACAGGACCACAGGACCGG + Intergenic
974472649 4:62338249-62338271 AGATCACAGGACCACAGGACCGG + Intergenic
974548716 4:63345724-63345746 AGATCACAGGACCACAGTACCGG - Intergenic
974983340 4:68989411-68989433 AGATCACAGGACCACAGGACTGG - Intergenic
975024921 4:69535815-69535837 AGATCACAGGACCACAGGACCGG - Intergenic
975248865 4:72153604-72153626 AGATCACAGGACCACAGGATGGG + Intergenic
975705213 4:77105008-77105030 GGGCCACAGAGCCTCAGGACTGG - Intergenic
976218064 4:82733174-82733196 GGACGACAGGAAAACAGGTCAGG + Intronic
976321576 4:83722843-83722865 GGAACACAGATCCTCAGGACAGG - Intergenic
976375387 4:84339847-84339869 AGATCACAGGACCACAGGACCGG + Intergenic
976816326 4:89151525-89151547 AGATCACAGGACCACAGGACCGG - Intergenic
977198699 4:94089714-94089736 GGAGCAAAGGACAAGAGGACAGG + Intergenic
977473527 4:97473587-97473609 AGATCACAGGAGCACAGGACCGG - Intronic
977605777 4:98984021-98984043 AGATCACAGAACCACAGGACCGG + Intergenic
978023878 4:103848335-103848357 ACATCACAGGACCACAGGACCGG + Intergenic
978211997 4:106148182-106148204 AGATCACAGGACCACAGGACTGG - Intronic
979256133 4:118609683-118609705 AGATCACAGGACCACAGGACCGG + Intergenic
979332214 4:119430854-119430876 AGATCACAGGACCACAGGACCGG - Intergenic
979678288 4:123433347-123433369 AGATCACAGGACCACAGGACCGG - Intergenic
979970080 4:127123869-127123891 AGATCACAAGACCACAGGACTGG + Intergenic
981421122 4:144551381-144551403 AGATCACAGGACCACAGGACCGG + Intergenic
982807891 4:159789254-159789276 AGATCACAGGACCACAGGACTGG - Intergenic
983221411 4:165047549-165047571 GGACTACAGGAGCAGATGACAGG - Intergenic
983419132 4:167495735-167495757 AGATCACGGGACCACAGGAATGG - Intergenic
983894154 4:173063721-173063743 AGATCACAGGACCACAGGACTGG + Intergenic
984064241 4:175028391-175028413 AGATCACAGGACCACAGGACTGG + Intergenic
985048244 4:185963860-185963882 GTACTACAGGATCACAGGATGGG - Intergenic
985608475 5:872157-872179 GCTCCACCGGAGCACAGGACGGG - Intronic
987583255 5:19822715-19822737 AGATCACAGGACCACAGGACTGG + Intronic
987826420 5:23035676-23035698 GGACCACAGTTCCACATGGCTGG + Intergenic
988343448 5:30005957-30005979 AGATCACAGAACTACAGGACCGG - Intergenic
988510318 5:31859055-31859077 GGGCCACAGGACCACTTGGCAGG - Intronic
988717756 5:33844645-33844667 AGATCATGGGACCACAGGACCGG - Intronic
989455078 5:41634749-41634771 AGATCACAGGACCACAGGACTGG - Intergenic
989572262 5:42955558-42955580 AGATCACAGGACCACAGGACCGG + Intergenic
989624374 5:43415379-43415401 AGATCACAGGATCACAGGACCGG - Intergenic
991292544 5:65046613-65046635 GGAACACCTGTCCACAGGACTGG - Intergenic
991626046 5:68602023-68602045 AGATCACAGGACCACAGGACTGG - Intergenic
992955201 5:81901291-81901313 AGATCACAGGACCACAGGACCGG - Intergenic
994322304 5:98407551-98407573 GGACTACAGTTCCACATGACTGG - Intergenic
994734360 5:103533918-103533940 AGATCACAGGACCACAGGACCGG - Intergenic
995120024 5:108526269-108526291 AGATCACAAGACCACAGGACTGG - Intergenic
995370933 5:111418353-111418375 AGATCACAGGACCACAGGATGGG + Intronic
995553704 5:113305559-113305581 GGACGAAAGGACTACATGACTGG - Intronic
995593943 5:113729017-113729039 AGATCACAGGACCACAGGACCGG + Intergenic
995608010 5:113879217-113879239 GGCTCACAGTTCCACAGGACTGG - Intergenic
996082883 5:119274697-119274719 GCACCACAGGTACACAGGGCAGG - Intronic
996100093 5:119436977-119436999 AGATCACAGGACCACAGGACCGG - Intergenic
996157967 5:120127059-120127081 GGAACACAGGGACACAGGAAGGG - Intergenic
997089776 5:130843308-130843330 AGATCACAGGACCACAGGACCGG - Intergenic
997244808 5:132338364-132338386 AGATCACAGGACCACAGGACCGG + Intronic
997304099 5:132825814-132825836 GGACCCCGGGACCACTGAACAGG - Exonic
997445480 5:133936660-133936682 GGGCCACAGAACCAGAGGAGGGG - Intergenic
997445486 5:133936680-133936702 GGGCCACAGAACCAGAGGAGGGG - Intergenic
997765459 5:136499079-136499101 AGATCACAGGACCACAGTATGGG + Intergenic
997920794 5:137977309-137977331 AGATCACAGGACCACAGGACTGG - Intronic
998266918 5:140673438-140673460 GGACCCCAGTACCACAGGAGAGG - Exonic
998461142 5:142311130-142311152 GTACCAAAGGACCAAAGGAAGGG + Exonic
998585159 5:143419715-143419737 AAATCACAGGACCACAGGACGGG + Intronic
998940038 5:147271864-147271886 AGATCACAGGACCACAGGACTGG - Intronic
999093212 5:148955617-148955639 AGATCACAGGACCACAGGACTGG + Intronic
999172974 5:149611053-149611075 AGACCATAGGACCACAGGTGAGG - Intronic
999320889 5:150614408-150614430 GGCCCCCAGGACCAGAGGACCGG - Intronic
999325105 5:150638957-150638979 GGATCACAGGATCACAGCCCAGG - Intronic
1000562673 5:162810166-162810188 AGATCACAGGACCACAGGACCGG - Intergenic
1000615281 5:163419277-163419299 AGATCACAGGACCACAGGACCGG - Intergenic
1002726935 5:181305201-181305223 AGATCACAGGACCACAGGACCGG + Intergenic
1003079421 6:3008942-3008964 AGATCACAGGACCACGGGACGGG + Intronic
1003575101 6:7285540-7285562 GGACCACAGGCGCACACCACAGG - Exonic
1003585313 6:7383209-7383231 GGATCACAGTTCCACATGACTGG - Intronic
1003931395 6:10927631-10927653 AGATCACAGGACCACAGGACCGG + Intronic
1004471288 6:15931696-15931718 AGATCACAGGACCACAGGACCGG + Intergenic
1004778268 6:18873440-18873462 AGATCACAGGACCACAGGACCGG - Intergenic
1005161150 6:22865588-22865610 GTACCACAGGACCATAGGCCGGG + Intergenic
1005971428 6:30764832-30764854 GGATCACAGGACCACAGGACCGG + Intergenic
1006418045 6:33916570-33916592 AGATCACAGGACCACAGGACCGG + Intergenic
1006577261 6:35055622-35055644 GGACAAAAGGAACACAGGGCCGG - Intronic
1006931569 6:37692137-37692159 GGCCCACAGGAGCCCAGGAAAGG + Intronic
1007730688 6:43943769-43943791 GGAGCACTGGACCACTGGTCTGG - Intergenic
1008100503 6:47385470-47385492 AGATCACAGGACCACAGGACTGG - Intergenic
1008170740 6:48202516-48202538 AGATCACAGGACCACAGGACGGG - Intergenic
1008909685 6:56719927-56719949 AGATCACAGGACCACAGGACTGG + Intronic
1009296552 6:61957712-61957734 AGATCACAGGACCATAGGACTGG - Intronic
1010102967 6:72131618-72131640 AGATCACAGGACCACAGGACTGG + Intronic
1011878432 6:91992138-91992160 AGATCACAGGACCACAGGACTGG + Intergenic
1012122641 6:95386714-95386736 AGATCACAGGACCACAGGACCGG + Intergenic
1012216484 6:96592017-96592039 AGATCACAGGACCATAGGACCGG + Intronic
1012960330 6:105615373-105615395 AGATCACAGGACCACAGGACCGG + Intergenic
1013216625 6:108033209-108033231 GGGAAACAGGAACACAGGACAGG - Intergenic
1014251429 6:119119221-119119243 AGATCGCAGGACCACAGGACCGG - Intronic
1014290683 6:119554298-119554320 AAATGACAGGACCACAGGACTGG - Intergenic
1014319339 6:119907329-119907351 AGATCACAGGACCACAGGACTGG - Intergenic
1014506713 6:122268584-122268606 TGACCACAGCACCACAAAACTGG + Intergenic
1015180816 6:130360583-130360605 AGAACACAGGACCACAGGACCGG + Intronic
1015545354 6:134356105-134356127 AGATCGCAGGACCACAGGACTGG - Intergenic
1016586789 6:145697382-145697404 AGATCACAGGACCACAGGACCGG + Intronic
1017508605 6:155092032-155092054 GGACCACAGGCCCACACCACTGG + Intronic
1017926824 6:158917885-158917907 GGACCCCAGGACTCCAGGATGGG + Intergenic
1018027806 6:159819378-159819400 GCACTCCAGGACCCCAGGACAGG - Intronic
1018921943 6:168181506-168181528 GGAGCCCAGGAGCACAGGCCTGG - Intergenic
1018985191 6:168630987-168631009 AGATCACAGGACCACAGGCCCGG - Intronic
1019337068 7:490550-490572 GGTCCAGAGGAGCCCAGGACAGG + Intergenic
1019415036 7:923187-923209 GGAACACAGCACCACATGCCCGG - Intronic
1020048455 7:5062512-5062534 AGATCACAGGACCACAGGACCGG + Intronic
1020387738 7:7626290-7626312 AGATCACAGGACCACAGGACCGG + Intergenic
1020803487 7:12760357-12760379 AGATCACAGGACCACAGGACCGG + Intergenic
1020909320 7:14108819-14108841 AGATCACAGGACCATAGGACGGG + Intergenic
1021139258 7:17003669-17003691 AGATCACAGGACTACAGGACCGG + Intergenic
1023565910 7:41523473-41523495 AGATCACAGGACCACAGGACTGG + Intergenic
1024403005 7:48946583-48946605 AGACCACAGGACCACAGGACCGG + Intergenic
1024586441 7:50845886-50845908 AGATCACAGGACCACAGGACCGG - Intergenic
1025155231 7:56599224-56599246 AGATCACAGGACCACAGGACTGG + Intergenic
1025600133 7:62986551-62986573 AGATCACAGGACCACAGGACTGG + Intergenic
1025734778 7:64137328-64137350 AGATCACAGGACCACAGGACTGG - Intronic
1025749475 7:64280878-64280900 AGATCACAGGACCACAGGACCGG + Intergenic
1026521831 7:71124339-71124361 CGATGACAGGACAACAGGACAGG + Intergenic
1027628814 7:80576843-80576865 AGATCACAGGACCACAGGACTGG - Intronic
1027793221 7:82658756-82658778 AGATCACAGGACCACAGGACTGG + Intergenic
1028017269 7:85731694-85731716 AGATCACAGGACCACAGGACCGG - Intergenic
1028368874 7:90068340-90068362 GGACTAGAGGAGCACAGGTCCGG + Intergenic
1028400881 7:90424185-90424207 AGATCACAGGACCACAGGACCGG - Intronic
1028539365 7:91925286-91925308 AGATCACAGGACCACAGGACCGG + Intergenic
1028787023 7:94807186-94807208 AGATCACAGGACTATAGGACCGG + Intergenic
1028799540 7:94947318-94947340 GGACCACAGGAATTCAGGAGAGG - Intronic
1028999818 7:97141254-97141276 AGATCACAGGACCACAGAACTGG - Intronic
1029370098 7:100144471-100144493 AGATCACAGGACCACAAGACGGG + Intergenic
1029699041 7:102234341-102234363 TGACCAAGGGACCAGAGGACAGG + Intronic
1030601439 7:111597408-111597430 AGATCACAGGACCACAGGACTGG - Intergenic
1031427003 7:121617263-121617285 AGATCACAGGACCACAGGACTGG - Intergenic
1031838258 7:126704865-126704887 AGATCACAGGACCACAGGACAGG - Intronic
1031930456 7:127680243-127680265 AGATCACAGGACCACAGGACTGG + Intronic
1033221004 7:139526052-139526074 GGACCACAGGCCATCAGGAGTGG - Intronic
1033269924 7:139921564-139921586 GGACCACAGGCACACACCACGGG - Intronic
1033426923 7:141253056-141253078 GGAGCATAGCACCACAGAACTGG - Intronic
1033859469 7:145607071-145607093 AGATCACAGGACCACAGGACTGG - Intergenic
1033877267 7:145837841-145837863 GGACCACATGGACACAGGAAGGG + Intergenic
1034583832 7:152071062-152071084 AGATCACAGGACTACAGGACTGG + Intronic
1034913424 7:155017090-155017112 GGACCACAGGTACACACCACTGG + Intergenic
1034947856 7:155275324-155275346 GGCCAACTGGACCACAGGAATGG - Intergenic
1034956895 7:155340389-155340411 GAACCACAGGACCCCAGGGATGG + Intergenic
1035027432 7:155835212-155835234 GGACCACAGGTGCACACGCCAGG + Intergenic
1035686871 8:1530005-1530027 AGATCACAGGACCACAGGACGGG + Intronic
1036158369 8:6363530-6363552 AGATCACAGGATCACAGGACTGG - Intergenic
1036999274 8:13698358-13698380 AGATCACAGGACCACAGGCCCGG + Intergenic
1038427134 8:27471026-27471048 GAAGGACAGGAACACAGGACAGG + Exonic
1039909199 8:41810756-41810778 GGGCCTCATGACCACAGGGCCGG + Intronic
1040025546 8:42778618-42778640 AGATCACAGGACCACAGGATGGG + Intronic
1040124878 8:43726013-43726035 AGCTCACAGGACCACAGGACTGG - Intergenic
1040393077 8:46966522-46966544 AGATCACAGGACCACAGGACCGG + Intergenic
1040510413 8:48088343-48088365 ATCCCACAGGCCCACAGGACTGG - Intergenic
1040517028 8:48143801-48143823 GGACCACAGGCACACAGCATTGG - Intergenic
1040634338 8:49254754-49254776 AGATCACAGGACCACAGGACCGG - Intergenic
1040840106 8:51776211-51776233 AGATCATAGGACCACAGGACTGG - Intronic
1041164129 8:55074211-55074233 AGATCACACGGCCACAGGACCGG - Intergenic
1041559674 8:59201788-59201810 AGATCACAGGACCACAGGACCGG + Intergenic
1041584136 8:59496169-59496191 AGATCACAGGACCACAGGACTGG + Intergenic
1041664899 8:60433782-60433804 AGATCACAGGACCACAGGACTGG + Intergenic
1041824150 8:62072960-62072982 AGATCACAGGACCACAGGACTGG + Intergenic
1042529248 8:69797833-69797855 AGATCACAGGACCACAGGACCGG - Intronic
1042933918 8:74039839-74039861 GAAGCACAGCACCACAGGATGGG + Intergenic
1042979476 8:74509194-74509216 GGACCACAGGACCAGTTGTCAGG + Intergenic
1043239582 8:77916103-77916125 GGAACACATGAACACAGGAAGGG - Intergenic
1043327482 8:79070430-79070452 AGATCACAGGACCACAGGACCGG - Intergenic
1043684767 8:83071527-83071549 AGACCACAGGACCACAGGACTGG + Intergenic
1043977520 8:86599826-86599848 AGATCACAGGACCACAGGACTGG - Intronic
1046076648 8:109320084-109320106 AGATCACAAAACCACAGGACTGG + Intronic
1047447631 8:124933704-124933726 AGATCACAGGACCACAGGACCGG - Intergenic
1048002931 8:130394503-130394525 AGATCACAGGACCACAGGACCGG - Intronic
1048820272 8:138373951-138373973 AGATCACAGGACCACAGGACAGG - Intronic
1048986698 8:139738636-139738658 GGACCCCAGAACCACACGGCGGG + Intronic
1049132435 8:140859302-140859324 GGGCCACAGGAACATGGGACAGG + Intronic
1049215163 8:141404435-141404457 AGACCCCAGGACCCCAGGACAGG - Intronic
1049513384 8:143041033-143041055 AGATCACAGGACCACGGGACCGG + Intronic
1049740319 8:144237358-144237380 GGGCAACAGGGCCTCAGGACAGG - Intronic
1050606421 9:7305965-7305987 GAACCACAGCAGCACAGGAAAGG - Intergenic
1050797180 9:9559739-9559761 GGACCACTTGACAACAGAACTGG - Intronic
1051549891 9:18316201-18316223 AGATCACAGGACCACAGGACCGG + Intergenic
1052009472 9:23389003-23389025 AGATCACAGGACCACAGGACCGG + Intergenic
1052083791 9:24239150-24239172 AGATCACAGGACCACAGGACTGG + Intergenic
1052426444 9:28311270-28311292 AGATCACAGGACCACAGGACCGG + Intronic
1054978025 9:71171240-71171262 AGATCACAGGACCACAGGACTGG - Intronic
1055343811 9:75313169-75313191 AGATCCCAGGACCACAGGACTGG + Intergenic
1055784864 9:79861971-79861993 AGATCACAGGACCACAGGACCGG - Intergenic
1055908030 9:81316254-81316276 AGATCACAGGACCACAGGCCCGG + Intergenic
1056536198 9:87529832-87529854 TGACCACAGAACAACAGAACAGG - Intronic
1057443839 9:95099925-95099947 TGTACACAGGACCACAGGACAGG + Exonic
1057538793 9:95944933-95944955 AGATCACAGGACCACAGGACCGG + Intronic
1057715680 9:97493506-97493528 AGATCACAGGACCACAGGACCGG + Intronic
1057750359 9:97787830-97787852 GGTCATCAGGACCACAGGAAGGG + Intergenic
1058268450 9:102937390-102937412 AGATCACAGGGCCACAGGACTGG - Intergenic
1058950955 9:109903322-109903344 GGACCACAGGGCCACTGGTTGGG + Intronic
1059022312 9:110590027-110590049 AGATCATGGGACCACAGGACCGG - Intergenic
1059281857 9:113141306-113141328 AGATCACAGGACCACAGGACCGG - Intergenic
1059346415 9:113631944-113631966 GGAACACAGGACCAGCAGACTGG - Intergenic
1060519862 9:124288121-124288143 GGTCCACAGGCCCAAAGGCCTGG + Intronic
1060783440 9:126430673-126430695 TGCCCTCAGGAGCACAGGACAGG - Intronic
1060877435 9:127093451-127093473 CCACCACAGCCCCACAGGACAGG - Intronic
1061061270 9:128251454-128251476 GGCCCACAGGAGCAGAGGCCAGG + Intronic
1062752056 9:138262677-138262699 AGATCACAGGACCACAGGACTGG + Intergenic
1186149963 X:6664410-6664432 AGATAACAGGACCACAGGACGGG + Intergenic
1186329166 X:8513989-8514011 AGATCACAGGACCACAGGACGGG - Intergenic
1187122475 X:16422865-16422887 AGATCACAGGACCACGGGACTGG - Intergenic
1187269459 X:17766614-17766636 GGAGCACAGGATCACAGTAACGG - Intergenic
1187433740 X:19248262-19248284 AGATCATAGGACCACAGGACCGG - Intergenic
1187845053 X:23525977-23525999 GAACCACAGCAACACAGGGCTGG + Intergenic
1188849544 X:35114864-35114886 AGATCACAGGACCACAGGACTGG - Intergenic
1188979400 X:36713567-36713589 AGATCACAGGACCACAGGACCGG + Intergenic
1189978962 X:46489976-46489998 AGATCACGGGACCACAGGACCGG + Intronic
1190002026 X:46698131-46698153 AGATCACAGGACCACAGGACCGG - Intronic
1190054768 X:47175182-47175204 GGGACACAGGGCCACAGGGCAGG - Intronic
1190128116 X:47723770-47723792 GGAGGACAGGACCAGAGGCCCGG - Intergenic
1190616319 X:52236686-52236708 AGATCACAGGACCACAGGACTGG - Intergenic
1191148417 X:57193414-57193436 AGATCACAGGACCACAGGACAGG - Intergenic
1191161078 X:57330500-57330522 AGATCACAGGACCTCAGGACCGG - Intronic
1191244856 X:58219175-58219197 AGATCACAGGACCACAGGACAGG + Intergenic
1191980876 X:66924129-66924151 AGATCACAGGACCACAGGACCGG - Intergenic
1192059708 X:67811666-67811688 AGATCACAGGGCCACAGGACTGG + Intergenic
1192752203 X:74005040-74005062 AGATCACAGGACCACAGGACTGG + Intergenic
1193301736 X:79897069-79897091 AGATCACAGGACCACAGGACTGG - Intergenic
1193594765 X:83432745-83432767 AGATCACAGGACCACAGGACCGG - Intergenic
1194101997 X:89717387-89717409 AGATCACAGGACCACAGGACTGG - Intergenic
1194194965 X:90881676-90881698 AGATCACAGGACCAGAGGACTGG - Intergenic
1194535940 X:95106012-95106034 AGATCACAGGACCACAGGACTGG - Intergenic
1194800795 X:98269853-98269875 GGACCACAGGACCACAGGACCGG - Intergenic
1194923283 X:99794103-99794125 AGATCACAGGACCATAGGACCGG - Intergenic
1195001536 X:100647628-100647650 AGACCACAGGACTAAAGGAGTGG + Intronic
1196697287 X:118626639-118626661 CGTCCTCAGGAACACAGGACAGG - Intronic
1196864520 X:120058787-120058809 GGAACACAGGCCCACAGCAAGGG - Intergenic
1196878581 X:120177544-120177566 GGAACACAGGCCCACAGCAAGGG + Intergenic
1197336045 X:125210553-125210575 GGACCACAGGAAGTCAGGAAAGG + Intergenic
1197364704 X:125549357-125549379 AGATCACAGGACCACAGGACAGG + Intergenic
1197473968 X:126897040-126897062 AGATCACAGGACCACAGGACTGG + Intergenic
1198023196 X:132679529-132679551 AGATCACAGGACCACAGGACTGG + Intronic
1199321293 X:146442335-146442357 AGATCACAGGACCACAGGACTGG - Intergenic
1199476989 X:148256829-148256851 AGATCACAGGACCACAGGACCGG + Intergenic
1199536438 X:148907694-148907716 AGATCACAGGACCACAGGACCGG + Intronic
1199643039 X:149881788-149881810 GGGACCCAGGACCCCAGGACAGG + Intronic
1199884214 X:152003076-152003098 AGATCACAGGACCACAGGACTGG - Intergenic
1199896358 X:152131075-152131097 GGTGCACAGGACCACTGGAGTGG + Intergenic
1199947436 X:152680278-152680300 GGCACCCAGGACCCCAGGACAGG + Intergenic
1199962244 X:152788176-152788198 GGCACCCAGGACCCCAGGACAGG - Intergenic
1200019197 X:153187939-153187961 GGTGCACAGGACCACTGGAGGGG - Intergenic
1200541586 Y:4464086-4464108 AGATCACAGGACCAGAGGACTGG - Intergenic
1200950479 Y:8893998-8894020 AGATCACAGGACCACAGGACTGG - Intergenic
1200978689 Y:9240999-9241021 AGATCACAGGACCACAGGACTGG - Intergenic
1201768741 Y:17597132-17597154 AGATCACAGGACCACATGACCGG - Intergenic
1201832813 Y:18308853-18308875 AGATCACAGGACCACATGACCGG + Intergenic
1202132705 Y:21628323-21628345 AGATCACAGGACCACAGGACTGG + Intergenic
1202302824 Y:23435653-23435675 TGACCACAGGTTCTCAGGACTGG - Intergenic
1202328795 Y:23722728-23722750 AGATCACATGACCACAGGACTGG - Intergenic
1202346280 Y:23931460-23931482 AGATCACAGGACCACAAGACCGG + Intergenic
1202368438 Y:24182313-24182335 GGACCACAGGAGTAGAGGCCAGG - Intergenic
1202502347 Y:25487804-25487826 GGACCACAGGAGTAGAGGCCAGG + Intergenic
1202524491 Y:25738630-25738652 AGATCACAGGACCACAAGACCGG - Intergenic
1202541976 Y:25947326-25947348 AGATCACATGACCACAGGACTGG + Intergenic
1202567987 Y:26234941-26234963 TGACCACAGGTTCTCAGGACTGG + Intergenic