ID: 933612722

View in Genome Browser
Species Human (GRCh38)
Location 2:84453994-84454016
Sequence CTGTTATTCCACTTCTAGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 127
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 119}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933612722_933612730 26 Left 933612722 2:84453994-84454016 CCCATCTAGAAGTGGAATAACAG 0: 1
1: 0
2: 0
3: 7
4: 119
Right 933612730 2:84454043-84454065 TATGAAATTACTCCTTAAATTGG 0: 1
1: 1
2: 1
3: 23
4: 250
933612722_933612726 -9 Left 933612722 2:84453994-84454016 CCCATCTAGAAGTGGAATAACAG 0: 1
1: 0
2: 0
3: 7
4: 119
Right 933612726 2:84454008-84454030 GAATAACAGCTGCCCCTGGGAGG 0: 1
1: 0
2: 1
3: 13
4: 158

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933612722 Original CRISPR CTGTTATTCCACTTCTAGAT GGG (reversed) Intronic
904130366 1:28271360-28271382 CTGTTTCTCCACTTTTAGGTAGG - Intronic
905955881 1:41995386-41995408 CTGATAATACAATTCTAGATTGG - Intronic
907698578 1:56759657-56759679 CTGTTCTGCCACTCCTACATAGG + Intronic
908632817 1:66129148-66129170 GTGTTATTCCTCTTGTAGCTTGG + Intronic
908707347 1:66973233-66973255 ATGTTAATCAACTTCTAGTTGGG + Intronic
909093388 1:71255511-71255533 CTGTTCTTCCATTGCTAGAAAGG - Intergenic
912929360 1:113942876-113942898 TTATTATTTCACTTCTTGATTGG - Intronic
913147623 1:116007701-116007723 CTGTTATTTCACTAATAGAGTGG - Intronic
916795542 1:168163755-168163777 CTGTAATCCCACTCCTAGAGAGG + Intergenic
917116287 1:171607146-171607168 CTGTTTTTCCACCTCTAAAATGG + Intergenic
917875908 1:179286764-179286786 CAGTTATTCCATTCCTACATGGG + Intergenic
918562197 1:185881945-185881967 CTGTACTTCCTCTTTTAGATGGG + Intronic
919644541 1:200081118-200081140 CTGTTTTTCCACTTGTTGCTTGG + Intronic
924062852 1:240194312-240194334 CAGTTATTCCACTTTTAACTGGG + Intronic
924316932 1:242807861-242807883 CCGCTGTTCTACTTCTAGATAGG + Intergenic
1065252433 10:23829379-23829401 CTGTTATTCGTCTTCTCCATGGG + Intronic
1065695416 10:28375309-28375331 ATATTATTGCACATCTAGATGGG - Intergenic
1072349932 10:94546431-94546453 CTGTTCTTCCTCTTCTAGCATGG - Exonic
1074427415 10:113363967-113363989 CTGTTATCCCCCTTGTTGATTGG + Intergenic
1074468737 10:113707497-113707519 CAGTTATTGCTCTTCTAGAGGGG + Intronic
1075347898 10:121697670-121697692 CTGTTATTCCACTTCTGTTGGGG - Intergenic
1079372898 11:19867159-19867181 CTGTTATTGCACTTACAAATGGG + Intronic
1080614764 11:33936163-33936185 CTGGAATTCAACTTCTAGGTGGG + Intergenic
1082206232 11:49437615-49437637 CTGGGTTTCCACTTCTGGATTGG + Intergenic
1082572945 11:54764676-54764698 CTGTTATTTGGCTTGTAGATCGG + Intergenic
1084489360 11:69470071-69470093 CAGTTATTCCACCAATAGATTGG - Intergenic
1086775185 11:90822102-90822124 TAGTTATTCCACTTCTATTTAGG - Intergenic
1091044235 11:132311729-132311751 CTATTATTCCAATTCTTTATTGG + Intronic
1091382787 12:73295-73317 CTGTTTTTCCACTTATAAAATGG + Intronic
1098300483 12:69048884-69048906 CTTAGATGCCACTTCTAGATGGG + Intergenic
1100418296 12:94402330-94402352 CTGTTTTACCACCTCTAGAATGG - Intronic
1102669849 12:114608793-114608815 GTGTGATTCCACTTATAGGTGGG - Intergenic
1105654313 13:22419430-22419452 CATTTTTTCCACTTCTAAATTGG - Intergenic
1112543217 13:100337573-100337595 CTGATATTCCACTTCAAAAGGGG - Intronic
1113730185 13:112636288-112636310 CAGTTCTTCCAATTCTGGATTGG - Intergenic
1116538367 14:46064799-46064821 CTGTTATTCCAAATATAAATTGG - Intergenic
1116794631 14:49376509-49376531 CTTCTATTCCACTTGTATATGGG + Intergenic
1119116906 14:72031683-72031705 GTGTTATTTCTCTTCTAGAAAGG - Intronic
1120011375 14:79419388-79419410 TCGTTATTCCATTTCTAGGTAGG + Intronic
1120719762 14:87878233-87878255 CCGTGATTCCACCTCTGGATAGG + Intronic
1122225414 14:100273991-100274013 CTGTTACCCTACTTCTGGATGGG - Intronic
1126261437 15:46697468-46697490 TTGTTCTTCCACTTATAAATAGG + Intergenic
1127706501 15:61552423-61552445 CTGTCATTCCAGGTCTAGTTTGG - Intergenic
1131571949 15:93546795-93546817 CTATTATTCCTCTTCTGTATGGG - Intergenic
1153733949 18:8044984-8045006 CAGTAATTCTACTTCTAGCTAGG + Intronic
1155134368 18:22973507-22973529 CTGTTTATCCACCTCTACATAGG + Intronic
1158668178 18:59451504-59451526 CTGTCATTTAACTTTTAGATGGG - Intronic
1168460204 19:56548700-56548722 CTCTTATTCAACTTTTAGGTGGG + Intronic
926568131 2:14500488-14500510 CTGTTATACAACTTTTTGATGGG + Intergenic
927436865 2:23074030-23074052 ATGTTGTTCCACTTCTAATTAGG + Intergenic
928739739 2:34337290-34337312 CTGTTATTCCATTTCTATGGAGG + Intergenic
929016235 2:37498889-37498911 CTGTAATTCCTCTTTGAGATCGG + Intergenic
929179626 2:39022592-39022614 CTGTTATTAAACTTATAGAGAGG - Exonic
930671612 2:54157755-54157777 GTGGTTTTCCAATTCTAGATGGG + Intronic
931577871 2:63738462-63738484 CTCATTTTCCACTTCTGGATTGG - Intronic
932991195 2:76789903-76789925 CTTCTATTTCACTTTTAGATGGG + Intronic
933612722 2:84453994-84454016 CTGTTATTCCACTTCTAGATGGG - Intronic
935122485 2:100195082-100195104 CTGTTATTCCAGTCATAGCTGGG - Intergenic
938087021 2:128408440-128408462 CTGTTATACCACATCTAGCCAGG + Intergenic
940017209 2:149119684-149119706 CTGTTATCACTCTGCTAGATAGG + Intronic
942474560 2:176304889-176304911 AAGTTATTCAAATTCTAGATAGG - Intronic
1169618715 20:7480084-7480106 CTGATTTTCCAGGTCTAGATTGG - Intergenic
1172071917 20:32263915-32263937 ATCTGATTCCCCTTCTAGATTGG + Intergenic
1172249072 20:33466106-33466128 CAGCAATTCCACTTCTAGGTGGG + Intergenic
1176282398 20:64321461-64321483 CTGTTTTTCCACTTATAAAATGG - Intergenic
1178729969 21:35092567-35092589 CAGCTATTCCACTCTTAGATGGG - Intronic
1179214127 21:39351154-39351176 CAGTCATTCCACTCCTAGAAAGG + Intergenic
1179936247 21:44606114-44606136 CTGTTTGTCCATTTTTAGATTGG - Intronic
1183855236 22:40628484-40628506 CTGTTACTGAATTTCTAGATAGG - Intronic
950606068 3:14081622-14081644 ATGTTACTCCACTGCTAGTTAGG - Intronic
950684826 3:14608925-14608947 CGGTTTTTCCCCCTCTAGATGGG + Intergenic
955865496 3:63379125-63379147 CTGTTATTGAATTTCTAGTTTGG + Intronic
955913215 3:63879775-63879797 CTGTTCTTGTATTTCTAGATCGG - Intronic
955949279 3:64225813-64225835 CTCTGATTCCACTCCTAGGTTGG - Intronic
959573299 3:107908592-107908614 CTGTTATTCCACTCCAGGGTAGG - Intergenic
962153561 3:132919230-132919252 CCCTTAGTCCACTTTTAGATGGG - Intergenic
964062387 3:152539294-152539316 CAGTTATTCCACTTCTTGCTGGG + Intergenic
966090741 3:176132877-176132899 CTGATATTCTGCTTCTAGAATGG - Intergenic
972523803 4:39887948-39887970 CTGTTTTCCCACTTTTAAATTGG - Intronic
972824698 4:42744255-42744277 CTGATACTGAACTTCTAGATAGG - Intergenic
975408820 4:74023919-74023941 TTTTTATTCCAATACTAGATAGG + Intergenic
979325565 4:119375281-119375303 TTGTTATGCCCCTTCCAGATAGG + Intergenic
983243477 4:165260426-165260448 TTGTTATGCCCCTTCCAGATAGG + Intronic
987860414 5:23479571-23479593 CTTGTATTTCACTTCTACATTGG + Intergenic
987901289 5:24015332-24015354 ATGTTATTGCACTTGGAGATAGG + Intronic
989478920 5:41905391-41905413 CTGTTGTCCCACTACTAGAGGGG - Intronic
993409638 5:87557892-87557914 CTGTCATGCCTCTTCTAGCTTGG + Intergenic
995521093 5:113006227-113006249 ATGTTATTCCATTCCTAAATAGG + Intronic
996198360 5:120638284-120638306 CTGTGATGCCATTTCTATATAGG - Intronic
997714638 5:136033042-136033064 CTGTTGTTCACATTCTAGATGGG - Intronic
1000076780 5:157796190-157796212 CTTTTTTGCTACTTCTAGATAGG + Intronic
1000206879 5:159069557-159069579 CTGTTATTCCATATCTGGTTAGG - Intronic
1000721549 5:164714421-164714443 CTTTTCTTCCACTTCTATTTTGG - Intergenic
1005265789 6:24111012-24111034 CAGCTCTTCCATTTCTAGATGGG + Intergenic
1011537161 6:88388619-88388641 CAGTAATTCCACTTTTAGGTGGG - Intergenic
1012643529 6:101652212-101652234 GTGTTATTGCACTTAGAGATGGG + Intronic
1013916959 6:115352157-115352179 CTTTTATTCCACATCTTTATGGG - Intergenic
1014782689 6:125582997-125583019 CAGTAATTCCACTTCTGGGTAGG - Intergenic
1015647107 6:135404431-135404453 TTGTTATTCCAATTTTAGAAAGG - Intronic
1016829894 6:148423956-148423978 CTATAATTCCACTACTTGATTGG - Intronic
1018779957 6:167054222-167054244 TTGTTTTTCTACTTCTAGGTAGG + Intergenic
1019925989 7:4192052-4192074 CTGTTGTTTAACTTCTAGATAGG + Intronic
1021757357 7:23865859-23865881 CTGTTATTCCTCTTTTACATAGG + Intergenic
1023203624 7:37724760-37724782 CTGTGATGCCTCTTCTAGCTGGG + Intronic
1027838972 7:83282483-83282505 TGGTTATTCTACTTCTGGATAGG - Intergenic
1033992923 7:147310058-147310080 CTGTTTTTCCACTTGGAGATTGG + Intronic
1035690232 8:1555129-1555151 CTGCTATTCCACTACGGGATTGG - Intronic
1038759161 8:30370401-30370423 TTTTTATTCCACTTATAAATGGG + Intergenic
1040139923 8:43897842-43897864 CTGTTATTTGACTTGGAGATTGG + Intergenic
1044335511 8:90979766-90979788 CTGGTATTTAACTTCTAAATTGG - Intronic
1047945817 8:129878234-129878256 CTTTTATTCCATTTCTATAAAGG - Intronic
1051179335 9:14394163-14394185 CTGTTTTTCCCCCACTAGATTGG - Intronic
1052335596 9:27316613-27316635 CTGTTACACCATTTCTAGATAGG - Intergenic
1052639470 9:31147346-31147368 TTGTTATTCCACATATAGAAAGG - Intergenic
1055395878 9:75874513-75874535 CTGTTATTCCATTTGTAGGTTGG + Intergenic
1055987494 9:82066358-82066380 CAGCAATTCCACTTCTAGATAGG + Intergenic
1186545542 X:10445301-10445323 CTGGGTTTCCACTTCTATATAGG + Exonic
1188683966 X:33046131-33046153 GTGTTATTCCAATCCTAGAGTGG + Intronic
1189700462 X:43713496-43713518 CTAGTATTCCACATCTATATGGG - Intronic
1190550322 X:51572708-51572730 CTGTTACTCCACTCCTTGAAGGG - Intergenic
1191699285 X:64022108-64022130 CTTTTATTCCATCTCTGGATGGG - Intergenic
1192212289 X:69135561-69135583 GTGTTATTCCATTTGCAGATGGG - Intergenic
1193312757 X:80026477-80026499 CAGTGATTCCATTTCCAGATTGG - Intronic
1194032053 X:88829348-88829370 CTGTTATGCCACTTTTAAAAGGG - Intergenic
1195151650 X:102077324-102077346 CTGTCAGTCCAATTCTATATTGG + Intergenic
1198496107 X:137195157-137195179 CTGTTTTTCCACCTCTAAAATGG + Intergenic
1201220431 Y:11764399-11764421 CCGCTGTTCTACTTCTAGATAGG + Intergenic