ID: 933613810

View in Genome Browser
Species Human (GRCh38)
Location 2:84463302-84463324
Sequence CAGATCATGCCAGACCTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933613805_933613810 0 Left 933613805 2:84463279-84463301 CCCAGCTGCAGGTTGTGGAGCCA No data
Right 933613810 2:84463302-84463324 CAGATCATGCCAGACCTGGGAGG No data
933613798_933613810 16 Left 933613798 2:84463263-84463285 CCTCAGCCCCTTCCTTCCCAGCT No data
Right 933613810 2:84463302-84463324 CAGATCATGCCAGACCTGGGAGG No data
933613804_933613810 4 Left 933613804 2:84463275-84463297 CCTTCCCAGCTGCAGGTTGTGGA No data
Right 933613810 2:84463302-84463324 CAGATCATGCCAGACCTGGGAGG No data
933613806_933613810 -1 Left 933613806 2:84463280-84463302 CCAGCTGCAGGTTGTGGAGCCAC No data
Right 933613810 2:84463302-84463324 CAGATCATGCCAGACCTGGGAGG No data
933613800_933613810 10 Left 933613800 2:84463269-84463291 CCCCTTCCTTCCCAGCTGCAGGT No data
Right 933613810 2:84463302-84463324 CAGATCATGCCAGACCTGGGAGG No data
933613801_933613810 9 Left 933613801 2:84463270-84463292 CCCTTCCTTCCCAGCTGCAGGTT No data
Right 933613810 2:84463302-84463324 CAGATCATGCCAGACCTGGGAGG No data
933613802_933613810 8 Left 933613802 2:84463271-84463293 CCTTCCTTCCCAGCTGCAGGTTG No data
Right 933613810 2:84463302-84463324 CAGATCATGCCAGACCTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933613810 Original CRISPR CAGATCATGCCAGACCTGGG AGG Intergenic
No off target data available for this crispr