ID: 933615702

View in Genome Browser
Species Human (GRCh38)
Location 2:84480456-84480478
Sequence CAGCTCCTCACTTGTAAACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933615696_933615702 14 Left 933615696 2:84480419-84480441 CCTCAGTTTTATATCTCACCTGG No data
Right 933615702 2:84480456-84480478 CAGCTCCTCACTTGTAAACAGGG No data
933615698_933615702 -4 Left 933615698 2:84480437-84480459 CCTGGAAACCTGTGTGCCTCAGC No data
Right 933615702 2:84480456-84480478 CAGCTCCTCACTTGTAAACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933615702 Original CRISPR CAGCTCCTCACTTGTAAACA GGG Intergenic
No off target data available for this crispr