ID: 933616175

View in Genome Browser
Species Human (GRCh38)
Location 2:84484492-84484514
Sequence CTTTCTCTACTGGAGGTTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933616168_933616175 28 Left 933616168 2:84484441-84484463 CCAAAACCAAAAGTTGGTATTTG No data
Right 933616175 2:84484492-84484514 CTTTCTCTACTGGAGGTTGTGGG No data
933616169_933616175 22 Left 933616169 2:84484447-84484469 CCAAAAGTTGGTATTTGAGCTCA No data
Right 933616175 2:84484492-84484514 CTTTCTCTACTGGAGGTTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933616175 Original CRISPR CTTTCTCTACTGGAGGTTGT GGG Intergenic
No off target data available for this crispr