ID: 933621374

View in Genome Browser
Species Human (GRCh38)
Location 2:84546179-84546201
Sequence CACTTGGCTCTCAGTGTCTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 249
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 223}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933621369_933621374 25 Left 933621369 2:84546131-84546153 CCATAGAGTGGCCTGTTCTGTAC 0: 1
1: 0
2: 0
3: 12
4: 148
Right 933621374 2:84546179-84546201 CACTTGGCTCTCAGTGTCTTGGG 0: 1
1: 0
2: 2
3: 23
4: 223
933621370_933621374 14 Left 933621370 2:84546142-84546164 CCTGTTCTGTACATTTCACACAT 0: 1
1: 0
2: 6
3: 78
4: 629
Right 933621374 2:84546179-84546201 CACTTGGCTCTCAGTGTCTTGGG 0: 1
1: 0
2: 2
3: 23
4: 223

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933621374 Original CRISPR CACTTGGCTCTCAGTGTCTT GGG Intronic
900118250 1:1037675-1037697 CACAGGGCTCTCAGGGTCCTAGG + Intronic
901092833 1:6653677-6653699 CACTTGGCTCCCAAGGTCTTGGG - Intronic
902135438 1:14300964-14300986 CTTGTGGCTCTCAGAGTCTTGGG + Intergenic
903795613 1:25927048-25927070 CCCTTGGCTCTCCCTCTCTTAGG - Intergenic
905024842 1:34842981-34843003 CGCCTGGCTCTCATTGTCATTGG - Intronic
905486546 1:38301250-38301272 AGGTTGGCTCTCAGTCTCTTGGG + Intergenic
911164228 1:94710754-94710776 CACATGGCTCACAGTGTACTTGG + Intergenic
914337073 1:146725044-146725066 CAGTGGGCTCTCAGTTTCTAAGG - Intergenic
915269809 1:154745995-154746017 CGCTTACCTCTCTGTGTCTTGGG + Intronic
915320703 1:155054556-155054578 CACATAGCTCTAAGTGTCTGGGG - Intronic
915759644 1:158297623-158297645 AACTTGCCACTCTGTGTCTTGGG - Intergenic
916843722 1:168627082-168627104 GACTTGGTTCTCAGTCTCTGGGG + Intergenic
918776525 1:188638835-188638857 CAGTAGGATCTCAGTGGCTTTGG - Intergenic
921398407 1:214693460-214693482 CATTTGGCTCACAGTTTATTTGG - Intergenic
921498460 1:215870059-215870081 CACTTGTTTCTCAGGGTCTCAGG - Intronic
922881804 1:228986602-228986624 CACTGCGCTCTCAGTGTCACAGG - Intergenic
923522737 1:234748432-234748454 CACTTTGCTCTCAGTTTTTGTGG + Intergenic
1063497771 10:6526313-6526335 TACTAGGCACTAAGTGTCTTAGG + Intronic
1064840588 10:19586888-19586910 CACCTGGCTCGGAGTGTCCTAGG - Intronic
1068149658 10:53115893-53115915 CACATGGCCCTCAGTGGCATAGG - Intergenic
1069003143 10:63288137-63288159 CAGTTGGCCCTCTGTGTCTGTGG - Intronic
1069017908 10:63451730-63451752 CAGTTGTCTCTCAGTATCGTGGG - Intronic
1070183305 10:74035751-74035773 CAGTTGGCTCTCTGTATCTGTGG + Intronic
1074169274 10:110917655-110917677 AACTTGGCTGGAAGTGTCTTGGG + Intronic
1074262986 10:111872464-111872486 CACTTGGGACTCACTGTCTTAGG + Intergenic
1075185609 10:120253843-120253865 CACTAGACTCTCAGTGCCATCGG + Intergenic
1075221007 10:120584537-120584559 TAAATGGATCTCAGTGTCTTTGG - Intronic
1078733786 11:14001120-14001142 CACTTGTCTCTCCATTTCTTGGG - Intronic
1079484298 11:20918602-20918624 CACTTGGCTCTCATTCTCTTTGG - Intronic
1080064413 11:27993732-27993754 AACTTGGCTCTTAGTAGCTTGGG - Intergenic
1080793501 11:35541721-35541743 CTCTTGGCTTTCATTGTTTTTGG + Intergenic
1082940732 11:58703035-58703057 CACTGGGCTCTGAGTTCCTTTGG - Intronic
1083903141 11:65653393-65653415 TACTAGGCTCTCAGTGTGCTAGG + Intergenic
1090359704 11:126163809-126163831 CTCTTGGGTCTCACTGTCTCGGG - Intergenic
1091348199 11:134870088-134870110 CACTTGGCTATGAGTGGCTCAGG + Intergenic
1092132776 12:6124236-6124258 CACTTGCCTCTGAGGGTCCTGGG - Intronic
1093237355 12:16627872-16627894 CACTTGGTCCACAGTGGCTTTGG - Intergenic
1093890074 12:24509257-24509279 CACTTGGCTCTTACTATCTTCGG - Intergenic
1094173676 12:27520942-27520964 CACTGGCCTCTGGGTGTCTTGGG - Intergenic
1095317350 12:40781332-40781354 CACTTGGGTCTCTGTCTCTTTGG + Intronic
1095457826 12:42407940-42407962 CAGTTGGCTCTGAGTATCTATGG - Intronic
1097597123 12:61647719-61647741 CCCTTGCCTCTCAGTCTCTGTGG + Intergenic
1097730670 12:63124495-63124517 CACTTTGCTCTAAGTCTCATGGG + Intergenic
1098896722 12:76071151-76071173 CAGTTGGCCCTCTGTGTCTGTGG - Intronic
1100451767 12:94713383-94713405 GACTTGGCTCTGAGTGTCTCAGG - Intergenic
1101157526 12:101941964-101941986 CTGGTGGCTCTCAGTGTATTGGG - Intronic
1101440336 12:104699754-104699776 CAGTTGGATCTCAGTGATTTGGG + Intronic
1102942427 12:116955099-116955121 CACTTGGCTCAAAGTTTCCTGGG - Intronic
1103935929 12:124476495-124476517 CAGTTTGCTCTCAGAGTTTTAGG - Intronic
1105293807 13:19071462-19071484 CTCTTTTCTCTCAGTCTCTTGGG - Intergenic
1105529243 13:21203228-21203250 AAGTTGGCTCTGGGTGTCTTTGG - Intergenic
1105750861 13:23420811-23420833 CACTTGACTCCAAATGTCTTGGG - Intronic
1105968006 13:25402389-25402411 CACTTGGCCCTGCGTGTGTTAGG + Intronic
1107300932 13:38964983-38965005 CGCATGGCTCTCAGTGTCGGAGG + Intergenic
1108434976 13:50392962-50392984 CATTTGGCTATCTGAGTCTTCGG + Intronic
1108530252 13:51321485-51321507 ATGATGGCTCTCAGTGTCTTGGG + Intergenic
1109331744 13:60939661-60939683 CCCTTGGCTCTCCGTCTCTGTGG - Intergenic
1109821962 13:67668616-67668638 CACTTATCTCTCAGTTTCTGTGG + Intergenic
1112145246 13:96692474-96692496 CAGTTGGTTCTCAGTATCTGTGG - Intronic
1113199923 13:107855684-107855706 CACCTGGCTCTTAATCTCTTGGG - Intronic
1113293584 13:108932846-108932868 CACCTGATTCTCAGTGTCTGTGG - Intronic
1115170254 14:30496770-30496792 AACTTGGCTGCCAGTGTTTTGGG - Intergenic
1115444151 14:33470138-33470160 CACCTGGCTTTCTTTGTCTTAGG - Intronic
1115758038 14:36549225-36549247 CACTTGCCTCTTGGTGTCTCAGG + Intergenic
1119565926 14:75629480-75629502 CACCTGTCTGCCAGTGTCTTTGG + Intronic
1119654540 14:76407796-76407818 CACGTGGGTCTCACTGGCTTTGG - Intronic
1119730452 14:76947780-76947802 CATTTAGCTCTGAGTGTTTTAGG - Intergenic
1121451977 14:94014345-94014367 CAGTTGTCCCTCAGTGTCTGTGG - Intergenic
1123014760 14:105368322-105368344 CAGGTGGCTCTGAGAGTCTTGGG + Intronic
1123702412 15:22925111-22925133 CAGTTGGCCCTCAGTGTTCTTGG - Intronic
1124270793 15:28278560-28278582 CAGTTGGCTCTCTGTGTCTGTGG - Intronic
1125763927 15:42120306-42120328 CAATTGGATCTCAGTGGTTTGGG - Intergenic
1127831357 15:62754261-62754283 CCCTTGGCTCTTAGTGTGTTAGG + Intronic
1128126765 15:65198672-65198694 CACCAGCCTCTCAGTGTCCTGGG + Exonic
1128534969 15:68483518-68483540 CACCTGGCCCTCACTGTCTCTGG - Intergenic
1129244105 15:74269377-74269399 CCCTTGGGTCTCAGTGTCCCTGG - Intronic
1129898553 15:79127574-79127596 CACTTGGATCACAGTTTCTCAGG + Intergenic
1130799011 15:87241858-87241880 CCCTTTACTCTCAGTGGCTTTGG + Intergenic
1130867385 15:87944440-87944462 CACTTATCTCTCAGTCTCTCAGG - Intronic
1133055550 16:3143941-3143963 CCCTGGGCTCTCAGTGCCCTGGG - Intergenic
1133901186 16:9976608-9976630 AACTTGGCTCTAAGTGTTCTTGG - Intronic
1135773880 16:25239039-25239061 CACTTGCCTCTCAGTTGCTCTGG - Exonic
1135995019 16:27241328-27241350 AAGTTGGCTCACAGTGGCTTGGG - Intronic
1136713989 16:32262407-32262429 CACTTGAGTTTCAGTGTCCTGGG + Intergenic
1137383832 16:48023224-48023246 CTCCTGGGTCTCACTGTCTTAGG - Intergenic
1137526490 16:49240945-49240967 CACTTGGGACTCAGTCTCTGAGG - Intergenic
1138316826 16:56077478-56077500 CACTTGGGTCTCTCTGTTTTAGG - Intergenic
1138646080 16:58426038-58426060 CTCTTGGTTCTTAGTGTTTTAGG - Intergenic
1139997197 16:70992275-70992297 CAGTGGGCTCTCAGTTTCTAAGG + Intronic
1141909371 16:87048032-87048054 CACTTGGGTCTCAGGGCCTCTGG - Intergenic
1203056065 16_KI270728v1_random:927345-927367 CACTTGAGTTTCAGTGTCCTGGG - Intergenic
1142486085 17:248413-248435 CACCTGGCTCTCAGAGTCCCTGG - Intronic
1142637016 17:1264102-1264124 CACATGGCTCTCAGCCTCCTGGG + Intergenic
1143500367 17:7335299-7335321 CACTTGAGACTCACTGTCTTTGG - Intergenic
1144494226 17:15736665-15736687 CAGCTGGCTCTCAGGGTCATTGG - Intronic
1144906035 17:18640011-18640033 CAGCTGGCTCTCAGGGTCATTGG + Intronic
1147506433 17:41022119-41022141 CAGTTGTCTCTCAGTGTACTGGG + Intergenic
1151815924 17:76471369-76471391 CACCTGCCTCTCTGAGTCTTGGG - Exonic
1152279419 17:79376493-79376515 CACTTGGCTGTGTGTGTTTTGGG - Intronic
1152646431 17:81470933-81470955 TACTGGGCTCTGAGTTTCTTGGG - Intergenic
1152706510 17:81846349-81846371 CTCTGGGCTCTCAGTGTCCTGGG - Intronic
1153650458 18:7235058-7235080 CACTTGGCTCTCAGTATGGAGGG + Intergenic
1154412739 18:14150143-14150165 CACTTGGCTCACCGGGTCATGGG - Intergenic
1161164600 19:2779485-2779507 CGTTTGGCACTCGGTGTCTTTGG + Intronic
1162408679 19:10491503-10491525 TACCCGGATCTCAGTGTCTTGGG + Intronic
1162728644 19:12704619-12704641 CAGTTGGCTCTCTGTATCTGTGG - Intronic
1165958497 19:39516174-39516196 CTCTTGTCTCTCATTCTCTTTGG + Intronic
1167900083 19:52614634-52614656 TACATGACTCTCAGTGTCTGTGG - Exonic
925820943 2:7799477-7799499 CAAGTGGCTCTCAGTGTCTGTGG + Intergenic
925961845 2:9024814-9024836 TAATTGGCTCTGAGTTTCTTGGG + Intergenic
929400246 2:41571789-41571811 CTCTTGGCTATGAGTGTCTGTGG - Intergenic
930147410 2:48021441-48021463 TACTTGGCTCTCATTGTCTTTGG - Intergenic
931569592 2:63654607-63654629 CAGTTGTCCCTCAGTGTCTGTGG + Intronic
932030093 2:68174657-68174679 CAGTTGTCCCTCAGTGTCTAAGG - Intronic
932569451 2:72930768-72930790 AACTGGGCTCTGAGTGTATTAGG - Intronic
933621374 2:84546179-84546201 CACTTGGCTCTCAGTGTCTTGGG + Intronic
933984811 2:87581754-87581776 CACTTGGCTCAGACTGGCTTGGG + Intergenic
934477312 2:94602269-94602291 CACCCGGCTCTCAGTGGCTCAGG + Intronic
934690749 2:96357006-96357028 CACTTGGCTCCAAGTGTTCTTGG - Intronic
934722179 2:96587456-96587478 CACTTGGCTTTCATTGACATTGG - Intergenic
936233736 2:110725746-110725768 CACATGGCTCTCAATGTCAGAGG - Intergenic
936309041 2:111369057-111369079 CACTTGGCTCAGACTGGCTTGGG - Intergenic
938032469 2:128007138-128007160 CAGTTGGCCCTCAGTTTCATAGG + Intronic
938113039 2:128581819-128581841 GACTTGACTTTCAGTGTCATTGG - Intergenic
940716965 2:157237119-157237141 AAAATGGCTCTCAGTGTGTTGGG - Intergenic
946041024 2:216782986-216783008 CACTTGGCTCATAGTTTCCTAGG + Intergenic
946084939 2:217161299-217161321 CACTTGCCTCTCAGTTTTTTTGG + Intergenic
946100312 2:217314926-217314948 CACTGGGCGCTCAGTGTCACTGG + Intronic
1169521788 20:6381664-6381686 CTCCTGGCTTTCAGTGTCTTAGG + Intergenic
1169905104 20:10594590-10594612 ATATTTGCTCTCAGTGTCTTGGG + Intronic
1170437958 20:16349841-16349863 CTCTTGGCCCTAAGTGTCTAGGG + Intronic
1171878404 20:30598858-30598880 CTCTTTTCTCTCAGTCTCTTGGG - Intergenic
1172473320 20:35217572-35217594 CTCTTCCTTCTCAGTGTCTTTGG + Intergenic
1175548798 20:59802238-59802260 CAGTTGGTTCTTAGTGTCATGGG + Intronic
1175968225 20:62670574-62670596 CACAGGGGTCTCAGTGTCTGCGG + Intronic
1176313230 21:5165961-5165983 CACTTGTCTCACTGTGTTTTTGG - Intergenic
1176652843 21:9565872-9565894 CCCTGGGCTGTCAGTGTGTTAGG + Intergenic
1176860267 21:14008112-14008134 CACTTGGCTCACCGGGTCATGGG + Intergenic
1176960779 21:15156463-15156485 CTCTTGGCTCACAGTGTGTCTGG - Intergenic
1177734633 21:25073221-25073243 CACTTGGCTCTCAGTTAGTCAGG + Intergenic
1179096315 21:38318962-38318984 CAGTTGGCCCTCTGTGTCTGTGG - Intergenic
1179843818 21:44096069-44096091 CACTTGTCTCACTGTGTTTTTGG + Intronic
1179911175 21:44449760-44449782 CAATTGGTCCTCAGTGGCTTTGG - Intergenic
1181819889 22:25467446-25467468 CACTTGGCTACCATTGCCTTTGG + Intergenic
1182419714 22:30243027-30243049 CACTTGGCATTCAGGCTCTTGGG - Exonic
1182714697 22:32348278-32348300 GCCTTGGCTCTCTGGGTCTTTGG - Intergenic
1183467102 22:37985303-37985325 CACTGGGCTCACCCTGTCTTGGG + Intronic
1184531853 22:45061405-45061427 CGCTAGACTCTCAGGGTCTTGGG - Intergenic
1185275124 22:49947442-49947464 CACTTGGCTCCCAGTGGACTTGG - Intergenic
1185365524 22:50434891-50434913 CACTTGGCTCTCTGGGTCGTGGG + Intronic
951780330 3:26355764-26355786 CACTTGTCCCTCAGTGTCCATGG + Intergenic
952955888 3:38556895-38556917 CACTGGGCTGTCAGTGTGATCGG + Intronic
956529993 3:70207860-70207882 CAGTTGTCCCTCAGTGTCTGAGG - Intergenic
956780741 3:72601191-72601213 CACTGGGTTCGCAGAGTCTTAGG - Intergenic
957471557 3:80665063-80665085 CAGTTGGCTCTCCGTGTCCATGG - Intergenic
957518939 3:81294226-81294248 CATTTGGCTTTCAGTGTCCAGGG + Intergenic
958027407 3:88064628-88064650 GGCTTGGCTTTCAGTTTCTTGGG + Intronic
958493988 3:94818705-94818727 CAGTTGTCCCTCAGTGTCCTTGG + Intergenic
958678595 3:97296577-97296599 CAGTTGGCTCTCAGGCTCTGGGG + Intronic
962593838 3:136918787-136918809 CAGTTGGCCCTCAGTATCTAAGG - Intronic
962604978 3:137025557-137025579 CACTGGGCTCTGACTGTCTGTGG + Intergenic
966396753 3:179511523-179511545 CACTTTGCCTTCAGAGTCTTTGG - Intergenic
968231056 3:197004795-197004817 CAGGTGGCTCTCAGTCTTTTTGG + Intronic
968651273 4:1761178-1761200 CACTTTGTTCCCAGTGTCTCCGG - Intergenic
969267641 4:6075284-6075306 CACTTGGCTTTCTGTATCTGTGG - Intronic
971272130 4:25160057-25160079 CATTTGGCTTTCACTGGCTTTGG + Intronic
971460419 4:26890040-26890062 CACTTGGCTCTCATTTTGCTTGG - Intronic
972187021 4:36541778-36541800 GACTTGGCTCGCTGAGTCTTGGG - Intergenic
972352675 4:38251517-38251539 CACTTGGATCTTAGTGCCTTGGG - Intergenic
975790836 4:77948657-77948679 CACAGTGCTCTCAGAGTCTTTGG + Intronic
976768726 4:88627560-88627582 CACTTGTCTCTCAGTATTTGTGG - Intronic
983548251 4:168986310-168986332 CAGTTGGCCCTCAGTATCTTTGG - Intronic
983805214 4:171985293-171985315 CACTTGGCTCTCATTTTCTCTGG - Intronic
985935576 5:3095183-3095205 AGCCTGGCTCTCAGTGTCTTTGG + Intergenic
985972151 5:3386926-3386948 CACTGGGCTCTCAGTGCCATGGG - Intergenic
986028772 5:3875516-3875538 CACTTTTCTCTTAGTGTATTTGG + Intergenic
986181863 5:5400564-5400586 CACTGCTCTCTCAATGTCTTGGG - Intergenic
988482751 5:31643194-31643216 CACTGGGCTCTCACTGACTTTGG - Intronic
988781488 5:34526759-34526781 CAGTTGGCCCTCAGTATCTGTGG - Intergenic
991097973 5:62759471-62759493 CAGTTGTCCCTCAGTATCTTCGG - Intergenic
991487993 5:67157726-67157748 CACTGGACTCTCAGTGACCTCGG + Intronic
991666868 5:69008067-69008089 AACTAGGAGCTCAGTGTCTTTGG - Intergenic
995219363 5:109630684-109630706 TACTTAACTCTCACTGTCTTTGG - Intergenic
997429882 5:133830321-133830343 CACTTGGCTCTCTGTACCTAGGG + Intergenic
999268115 5:150280185-150280207 AACGTGGCTCTGAGTGGCTTGGG - Intronic
1002013302 5:176302203-176302225 CAGTTGGCTCTCTGTATCTGTGG - Intronic
1002618647 5:180470740-180470762 CCCTTGGCTCTCCCTGGCTTTGG - Intergenic
1003424553 6:5989342-5989364 CATTTTGGTCTCAGTGTCTCTGG - Intergenic
1004201221 6:13549743-13549765 CACTCAGCTATCAGTGTCTTTGG - Intergenic
1006238235 6:32654692-32654714 CAGTTGGCTCTCTGTATCTGTGG - Intergenic
1009013395 6:57870275-57870297 GACACTGCTCTCAGTGTCTTTGG - Intergenic
1011342940 6:86337925-86337947 CACCTGGCTCTGAGTGTCAAGGG + Intergenic
1012744179 6:103062579-103062601 TAATTATCTCTCAGTGTCTTTGG - Intergenic
1019308807 7:348981-349003 CACTGGGTTCTCTGTGTCTCAGG - Intergenic
1019938822 7:4273459-4273481 CCCTTGCCTCTCTCTGTCTTAGG + Intergenic
1019998850 7:4743105-4743127 CACCAGGCTCTCAGTCACTTAGG - Intronic
1020814092 7:12882963-12882985 CACTTGCATCTCAGTGTCTCTGG - Intergenic
1021048533 7:15953755-15953777 CTTTTGGCTCTCTGTTTCTTAGG - Intergenic
1021810112 7:24394864-24394886 CACCTGGCTCTTACTTTCTTGGG + Intergenic
1024526147 7:50350902-50350924 CACTTGGCTCCCTGGGTCCTTGG - Intronic
1025757716 7:64360483-64360505 CATCTGGCACTCAGTGTCATGGG - Intergenic
1026386840 7:69858276-69858298 CACCTGGATGTCAGTGCCTTGGG + Intronic
1026809504 7:73451034-73451056 TAGTTCTCTCTCAGTGTCTTTGG - Intronic
1028645130 7:93087020-93087042 CAGGTGGCTCTCAGGTTCTTGGG + Intergenic
1031709358 7:125025474-125025496 CACTTGGCTCTCTCTTTATTGGG + Intergenic
1037449512 8:19002810-19002832 CACTTAGCTCTCTGTTTCTATGG - Intronic
1039144188 8:34427286-34427308 CACTTTGCTTTCAGGGTTTTTGG + Intergenic
1041792301 8:61710720-61710742 CAATTGGCTCTGATGGTCTTTGG + Intronic
1042813823 8:72855787-72855809 CAGTTGCCCCTCAGTATCTTTGG + Intronic
1046701943 8:117410787-117410809 CATTTGGCACTCAGTGTGTATGG + Intergenic
1047969692 8:130074037-130074059 GATTTGTCTCTAAGTGTCTTAGG - Intronic
1048800289 8:138188571-138188593 CTCATGGCTCTCTGTGACTTGGG + Intronic
1049516929 8:143064646-143064668 CAATTGGCTTTCTGTGTCTGTGG + Intergenic
1052196193 9:25717824-25717846 AAGTTGTCTCTCAGTTTCTTTGG - Intergenic
1052852657 9:33387293-33387315 CACCCGGCTCTCAGTGGCTCAGG - Intronic
1053680757 9:40483844-40483866 CACCCGGCTCTCAGTGGCTCAGG - Intergenic
1053930742 9:43112156-43112178 CACCCGGCTCTCAGTGGCTCAGG - Intergenic
1054282956 9:63141091-63141113 CACCCGGCTCTCAGTGGCTCAGG + Intergenic
1054293839 9:63319359-63319381 CACCCGGCTCTCAGTGGCTCAGG - Intergenic
1054391863 9:64623848-64623870 CACCCGGCTCTCAGTGGCTCAGG - Intergenic
1054503866 9:65892480-65892502 CACCCGGCTCTCAGTGGCTCAGG + Intronic
1055066459 9:72123951-72123973 CACTGGCTTCTCACTGTCTTTGG - Intronic
1056399068 9:86209431-86209453 CACTTTACTCTCATTGTGTTGGG - Intergenic
1056543380 9:87593246-87593268 GAGTTTGCACTCAGTGTCTTGGG - Intronic
1057266526 9:93621353-93621375 CTCTTTTCTCTCAGTCTCTTGGG + Intronic
1058153319 9:101486100-101486122 CACTGCGCTCGCGGTGTCTTGGG - Intronic
1060268178 9:122124371-122124393 CCCTTGGCTCTCAGGCTCTCAGG + Intergenic
1060904285 9:127290988-127291010 CAGTTGGCTCCCACTGTCCTTGG - Intronic
1061506278 9:131033639-131033661 CACTTGGCTGTCAGGGGTTTGGG - Intronic
1203690215 Un_GL000214v1:35443-35465 CACTTCACTCTCATTGTTTTGGG + Intergenic
1203630572 Un_KI270750v1:69413-69435 CCCTGGGCTGTCAGTGTGTTAGG + Intergenic
1203646060 Un_KI270751v1:68610-68632 CACTTCACTCTCATTGTTTTGGG - Intergenic
1186019461 X:5237752-5237774 CACTTGGCTCTCATTCTCTCTGG - Intergenic
1186727042 X:12368206-12368228 CACTTGCCTCTGAGTGTTGTGGG - Intronic
1187809172 X:23156792-23156814 TACTTGTCTCTCAGTTTCTAAGG - Intergenic
1187856001 X:23636762-23636784 GACTTGGCTCCCTTTGTCTTTGG - Intergenic
1188143456 X:26581174-26581196 CTCTTGGCTTTCAGTCTCATGGG + Intergenic
1189569570 X:42281471-42281493 CACTTGTCTCTCAGTATCCATGG + Intergenic
1189866567 X:45336048-45336070 CACTTGTCCCTCAGTATCTATGG + Intergenic
1191040059 X:56069130-56069152 CACTTGGCTGTCAGTGGCATGGG - Intergenic
1193772992 X:85609743-85609765 TACTGGACTCTCAGTGTTTTGGG - Intergenic
1194553623 X:95331382-95331404 CACCAGGCTCCCAGTGTCATGGG + Intergenic
1197826715 X:130597960-130597982 CACTCAGCTCTCAGTCTTTTGGG - Intergenic
1197862294 X:130983812-130983834 CACTTGTCCCTCAGTGTCCATGG - Intergenic
1198497576 X:137208187-137208209 TAGTTGTCTCTCAGTGTCCTTGG + Intergenic
1199342338 X:146695686-146695708 CAGTTGGCTCTCTGTATCTGTGG + Intergenic
1199448423 X:147953419-147953441 CACTTGGCACTCAGTTTCTCAGG - Intergenic
1199480797 X:148296658-148296680 CACTTGGCTCTCATTCTGTCTGG + Intergenic
1201558035 Y:15285231-15285253 CACTTGGTTCTCTGTCACTTAGG + Intergenic