ID: 933621375

View in Genome Browser
Species Human (GRCh38)
Location 2:84546180-84546202
Sequence ACTTGGCTCTCAGTGTCTTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 240
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 221}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933621369_933621375 26 Left 933621369 2:84546131-84546153 CCATAGAGTGGCCTGTTCTGTAC 0: 1
1: 0
2: 0
3: 12
4: 148
Right 933621375 2:84546180-84546202 ACTTGGCTCTCAGTGTCTTGGGG 0: 1
1: 0
2: 1
3: 17
4: 221
933621370_933621375 15 Left 933621370 2:84546142-84546164 CCTGTTCTGTACATTTCACACAT 0: 1
1: 0
2: 6
3: 78
4: 629
Right 933621375 2:84546180-84546202 ACTTGGCTCTCAGTGTCTTGGGG 0: 1
1: 0
2: 1
3: 17
4: 221

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933621375 Original CRISPR ACTTGGCTCTCAGTGTCTTG GGG Intronic
900559074 1:3294743-3294765 ACTTGCCTCTGAGTCTCTCGTGG - Intronic
900697756 1:4022819-4022841 TCCTGGCTCCCAGTGTGTTGGGG + Intergenic
902867287 1:19287972-19287994 ACTTTGCTCTGAGTACCTTGTGG - Intronic
904183447 1:28683688-28683710 ACTTGGGTTTTAGTGTCTTCAGG - Exonic
906617160 1:47241306-47241328 CCTTGGCTCTCTCTGCCTTGAGG - Intergenic
906948921 1:50318706-50318728 ACTTGGCTCCCAGACTTTTGAGG + Intergenic
907553290 1:55322966-55322988 CCTTTGCTCTAGGTGTCTTGAGG + Intergenic
912795191 1:112689103-112689125 TCTTGGCTAGCAGTGACTTGTGG - Exonic
915759643 1:158297622-158297644 ACTTGCCACTCTGTGTCTTGGGG - Intergenic
917449238 1:175133131-175133153 GCTTGGCTCTCAAGGTCATGTGG + Intronic
920746173 1:208630932-208630954 AGGTGAGTCTCAGTGTCTTGTGG - Intergenic
921182326 1:212641399-212641421 ACTCAGCTCTCATTGGCTTGGGG - Intergenic
921186068 1:212670566-212670588 AGTTGTCTCTCAGTATCTTCCGG - Intergenic
923024029 1:230190115-230190137 AAGTGGCTGTCAGTGTCTTTAGG + Intronic
923665654 1:235996353-235996375 CCTTGGCTCTCCATGCCTTGTGG - Intronic
924750656 1:246885829-246885851 AGTTGGCTCTCAGTATCTACAGG + Intronic
924759704 1:246972268-246972290 ACTTGGCTCACAATGCCCTGTGG + Intronic
1064370129 10:14744489-14744511 AAATGGCTCTTAGTGTTTTGAGG + Intronic
1064381152 10:14842869-14842891 AGTTGGGTCCCAGAGTCTTGTGG + Intronic
1066624883 10:37396215-37396237 CCTTGGCTCTCACTGTCCTCAGG - Intergenic
1069017907 10:63451729-63451751 AGTTGTCTCTCAGTATCGTGGGG - Intronic
1070421742 10:76244210-76244232 ACTTGTCTCTCAGTATCGTGAGG + Intronic
1073596325 10:104803967-104803989 ACTTGGGTCTCAGTCTTGTGTGG - Intronic
1073873434 10:107892774-107892796 ACATGGCCTTCATTGTCTTGAGG + Intergenic
1074104041 10:110375742-110375764 ACTGGGCACTCAGTGTGTTCTGG + Intergenic
1074262987 10:111872465-111872487 ACTTGGGACTCACTGTCTTAGGG + Intergenic
1076428822 10:130387546-130387568 CCTTCTCTCTCAGTGTCTGGTGG - Intergenic
1078733785 11:14001119-14001141 ACTTGTCTCTCCATTTCTTGGGG - Intronic
1079343408 11:19631631-19631653 ACTTCACTCTCAGTGTTTTAAGG + Intronic
1080425095 11:32147600-32147622 ACTTGGCTCTCAATTTCTAAAGG - Intergenic
1080563955 11:33491064-33491086 ACTAGACTCTGAGTTTCTTGAGG + Intergenic
1080681260 11:34478244-34478266 ACTAGTTTCTCAGTCTCTTGTGG - Intergenic
1082177596 11:49079250-49079272 CCTTGGCTTTCATTGGCTTGTGG + Intergenic
1084840290 11:71840752-71840774 ACATGCCTCCCAGGGTCTTGAGG + Intergenic
1085858811 11:80207720-80207742 GCTTGGCTCTCATTGTCTCTTGG - Intergenic
1086688124 11:89756624-89756646 CCTTGGCTTTCATTGGCTTGTGG - Intergenic
1086717727 11:90083275-90083297 CCTTGGCTTTCATTGGCTTGTGG + Intergenic
1086940438 11:92792228-92792250 ACTTGACTCTAAGCTTCTTGAGG + Intronic
1090359703 11:126163808-126163830 TCTTGGGTCTCACTGTCTCGGGG - Intergenic
1092132775 12:6124235-6124257 ACTTGCCTCTGAGGGTCCTGGGG - Intronic
1092747123 12:11683690-11683712 AGTTTGCTCTCAGTTCCTTGAGG - Intronic
1094173675 12:27520941-27520963 ACTGGCCTCTGGGTGTCTTGGGG - Intergenic
1101157525 12:101941963-101941985 TGGTGGCTCTCAGTGTATTGGGG - Intronic
1101440337 12:104699755-104699777 AGTTGGATCTCAGTGATTTGGGG + Intronic
1102569454 12:113818714-113818736 TCTAGGCTCTCAGTGTCTCCAGG - Intronic
1105293806 13:19071461-19071483 TCTTTTCTCTCAGTCTCTTGGGG - Intergenic
1109918749 13:69027418-69027440 CCTTTGCTCTGAGTGACTTGGGG + Intergenic
1110011598 13:70341667-70341689 ACTGGGCTCCCAGTCTCTTCTGG - Intergenic
1116591569 14:46782349-46782371 AATAGGCCCTCAGTGTCTTCTGG - Intergenic
1120266862 14:82261910-82261932 ACTTGGCTCTCTGTGTGTCTTGG + Intergenic
1121308293 14:92921129-92921151 AAATCACTCTCAGTGTCTTGTGG - Intergenic
1121358292 14:93232733-93232755 ACATGGCACTCACGGTCTTGGGG - Intergenic
1121857868 14:97286805-97286827 GCTTGGGTTTCAGTGGCTTGAGG + Intergenic
1123690835 15:22837487-22837509 AATCTGCTCTCAGTGTCTCGAGG + Intergenic
1124270792 15:28278559-28278581 AGTTGGCTCTCTGTGTCTGTGGG - Intronic
1126824696 15:52537475-52537497 TCCTGGCTTTCAGTGTTTTGTGG + Intergenic
1126830015 15:52592400-52592422 ACTTGTCTCTCTTTGTCTTTTGG + Intronic
1127446213 15:59065995-59066017 ACTTGGCTGGCTGTGTCTTAAGG + Intronic
1128126766 15:65198673-65198695 ACCAGCCTCTCAGTGTCCTGGGG + Exonic
1130023817 15:80253093-80253115 ACATGATTCTCAGTGTCATGTGG + Intergenic
1130194832 15:81769722-81769744 ACTAGGTTCTCAATGTTTTGAGG - Intergenic
1130440750 15:83951160-83951182 ACATGGCTTTCATTGTGTTGAGG + Intronic
1132731235 16:1363022-1363044 ACTTGGCTCTGGGCGTCTCGTGG - Exonic
1136002834 16:27308538-27308560 TCTTGGATCTCAGTGTCCTTAGG + Intergenic
1136272548 16:29157178-29157200 CCCTGCCTCTCATTGTCTTGGGG - Intergenic
1137367135 16:47870385-47870407 ACTAGGTTCTCAGTGCCTTCAGG + Intergenic
1137942848 16:52705698-52705720 ACTTCACTCTCAGTATCTTGAGG + Intergenic
1138649203 16:58448980-58449002 CCTTGGCTCTCTGTGTGCTGAGG - Intergenic
1139259408 16:65577520-65577542 AGTTAGCTCTCAGTGCCCTGGGG - Intergenic
1142076104 16:88118987-88119009 CCCTGCCTCTCATTGTCTTGGGG - Intergenic
1143502585 17:7347831-7347853 CCTTGCCTCCCAGTGTCTTCAGG + Intronic
1143670781 17:8394307-8394329 ACTTGGCTACCAGTGACTTCTGG - Exonic
1143901456 17:10177637-10177659 ACTTGGCTTTCTATGGCTTGTGG - Intronic
1147390314 17:40105245-40105267 ACTTGTTTCTCAGTGTGGTGGGG + Intergenic
1148788878 17:50161842-50161864 ACCTGTCTCTAAGTCTCTTGAGG - Intergenic
1151025404 17:70671128-70671150 ACATGGCTCTTAGGCTCTTGGGG + Intergenic
1151428829 17:74049044-74049066 ACTTCTCTCTCAGGGTCTGGGGG + Intergenic
1152279418 17:79376492-79376514 ACTTGGCTGTGTGTGTTTTGGGG - Intronic
1152646430 17:81470932-81470954 ACTGGGCTCTGAGTTTCTTGGGG - Intergenic
1154002153 18:10490989-10491011 ACTTGACTGTCAGGCTCTTGTGG + Intergenic
1155398587 18:25414210-25414232 ACTTGGTTTTCAGAGGCTTGTGG + Intergenic
1156620762 18:38848761-38848783 ACTTAACTCTAAGTTTCTTGAGG + Intergenic
1156914095 18:42445210-42445232 ACTTGGCTCTCAGGGAGCTGAGG - Intergenic
1157753584 18:50198683-50198705 ACTAGGTTCTAAGAGTCTTGAGG + Intergenic
1157959728 18:52139523-52139545 ACTTGGCTCCCAGAACCTTGGGG - Intergenic
1159776991 18:72613882-72613904 ACTTCCTTTTCAGTGTCTTGTGG + Intronic
1163554529 19:17984590-17984612 GCTTGGCTCTCTGGGTCTGGGGG - Intronic
1164439508 19:28262368-28262390 ACTTGGCTCTCAGGGTCTCCTGG + Intergenic
1166406402 19:42524929-42524951 ACATGGGTCTCAGTCTCTGGAGG + Intronic
925820944 2:7799478-7799500 AAGTGGCTCTCAGTGTCTGTGGG + Intergenic
925961846 2:9024815-9024837 AATTGGCTCTGAGTTTCTTGGGG + Intergenic
927419457 2:22915041-22915063 ACTTGCCTGTCAGGGTCCTGTGG - Intergenic
932115411 2:69042397-69042419 ACTTGGATCTCAGAGACTAGTGG - Intronic
933621375 2:84546180-84546202 ACTTGGCTCTCAGTGTCTTGGGG + Intronic
933984812 2:87581755-87581777 ACTTGGCTCAGACTGGCTTGGGG + Intergenic
935147942 2:100408974-100408996 TCCTGGCTCTGAGTGTCCTGGGG + Intronic
936052246 2:109233295-109233317 AGGTGGCTCTCAGTGGGTTGGGG + Intronic
936309040 2:111369056-111369078 ACTTGGCTCAGACTGGCTTGGGG - Intergenic
937970485 2:127545493-127545515 ACTTGTCTCTCAGAGAGTTGAGG - Intronic
938212330 2:129479042-129479064 TCCTGGCATTCAGTGTCTTGAGG + Intergenic
940174226 2:150860896-150860918 ACTTGGCTCTCATTTTCTCTTGG + Intergenic
940716964 2:157237118-157237140 AAATGGCTCTCAGTGTGTTGGGG - Intergenic
941663780 2:168223073-168223095 ACTTGGCTCAGTGTGTTTTGTGG - Intronic
942161213 2:173189924-173189946 ACTTGGCACTCAAGGTTTTGTGG - Intronic
943325386 2:186491291-186491313 ACAAGGTTCTCAGTGTTTTGGGG + Intronic
943348446 2:186769497-186769519 ACTTGTCTCTCAGTTCCTAGAGG + Intergenic
943379028 2:187119987-187120009 ACTTTATTCTCAGTGTATTGTGG + Intergenic
945428757 2:209739680-209739702 ACTTGGCTCTTAATGCCTTGAGG - Intergenic
947015845 2:225618774-225618796 ACTTGGTTCTAAGGGCCTTGGGG + Intronic
947736013 2:232455980-232456002 GTGTGGCTCACAGTGTCTTGTGG - Intergenic
1169269283 20:4187061-4187083 CCTTGGCTCTTTCTGTCTTGAGG - Intronic
1171878403 20:30598857-30598879 TCTTTTCTCTCAGTCTCTTGGGG - Intergenic
1172490502 20:35332786-35332808 ACTTTGCTCTCAGAGTTTGGAGG - Intronic
1173152613 20:40580829-40580851 AGTTTGCTCTCAGTGCATTGGGG - Intergenic
1173254852 20:41387094-41387116 GCTTGGCTCACAGTGTCCTCAGG - Intergenic
1174165494 20:48580981-48581003 ATTAGGCTCTCAGTGCCATGAGG + Intergenic
1176215791 20:63947117-63947139 ACTTGGGTCTGTGTGTCCTGTGG - Intronic
1178426885 21:32485774-32485796 ACTTAGGTCTCAGTGTTTGGTGG - Intronic
1179649747 21:42800375-42800397 AGGTGGCTCTCAGGCTCTTGAGG - Intergenic
1182419713 22:30243026-30243048 ACTTGGCATTCAGGCTCTTGGGG - Exonic
1182501757 22:30753218-30753240 AGGAGGCCCTCAGTGTCTTGGGG + Intronic
1183615909 22:38945212-38945234 ACTAGACTCTCAGTGTCTTGAGG + Intergenic
1184531852 22:45061404-45061426 GCTAGACTCTCAGGGTCTTGGGG - Intergenic
1184721866 22:46319354-46319376 ACCTGGCCCTCACTGTGTTGGGG + Intronic
949601409 3:5602138-5602160 ACTTGCCACTCTGTGCCTTGGGG - Intergenic
949849488 3:8408493-8408515 ACTTGGCTCTCAAAGTGTTTAGG + Intergenic
950298521 3:11853126-11853148 CCTTCTCTCTCAGTGTCTTCTGG + Intergenic
951304038 3:21035682-21035704 CTTTGGCTATTAGTGTCTTGTGG + Intergenic
954028441 3:47801655-47801677 ACTAGGCTCTAAGTCCCTTGAGG + Intergenic
955122590 3:56075626-56075648 ACTAGACTGTCAGTTTCTTGAGG + Intronic
955340303 3:58120292-58120314 TCAAAGCTCTCAGTGTCTTGGGG - Intronic
955422039 3:58748534-58748556 ACATAGCTCTCAGGGTCCTGGGG - Intronic
956073448 3:65479318-65479340 GCTTGACTCTCAGAGTCATGCGG + Intronic
957305368 3:78451071-78451093 ACTTGGCTCACAGTCACATGTGG - Intergenic
958484889 3:94692621-94692643 ACTGGACTCTAAGTTTCTTGAGG - Intergenic
960384674 3:117007580-117007602 ACTTGACTCCCACTGTCTTAAGG - Intronic
962293049 3:134153748-134153770 ACTTGGCTGTGAGTTCCTTGAGG - Intronic
963646196 3:147917826-147917848 ACTAGACTATGAGTGTCTTGAGG - Intergenic
963854978 3:150244153-150244175 ACTTGGCTGTAAGTTTCTTTAGG - Intergenic
964113158 3:153107807-153107829 ACTAGGCTGTAAATGTCTTGAGG + Intergenic
965795371 3:172433369-172433391 ACATGTTTCTCATTGTCTTGGGG + Intergenic
966079784 3:175987216-175987238 AATAGGCTCACAGTGTCTTCTGG + Intergenic
966135160 3:176689951-176689973 GCTTGCATATCAGTGTCTTGTGG - Intergenic
966573383 3:181472771-181472793 AGATGGCTCTCATTGTTTTGAGG + Intergenic
968321719 3:197775376-197775398 ACTTGGCCCTCTGTGTCTCAAGG + Intronic
969781382 4:9406755-9406777 ACATGCCTCTCAGCGTCTTGAGG + Intergenic
969852746 4:9974133-9974155 AGTTGGCTCTCATTATTTTGAGG - Intronic
971787501 4:31123795-31123817 AAGTGGCTCTCAGTGTGATGGGG + Intronic
971866070 4:32174084-32174106 ACTTGTCTTTCTGTGTCATGGGG + Intergenic
972187020 4:36541777-36541799 ACTTGGCTCGCTGAGTCTTGGGG - Intergenic
972352674 4:38251516-38251538 ACTTGGATCTTAGTGCCTTGGGG - Intergenic
973191741 4:47393310-47393332 ACTAGGCTCTGAGCTTCTTGAGG - Intronic
978093994 4:104752710-104752732 ACTTGCCTCAAAGTGTTTTGAGG + Intergenic
981198638 4:141950807-141950829 AGATGGCTCTCAGTATTTTGAGG - Intergenic
982725766 4:158903941-158903963 ACTTTGCTCTCAGAATCTTGTGG + Intronic
983548250 4:168986309-168986331 AGTTGGCCCTCAGTATCTTTGGG - Intronic
985168439 4:187122799-187122821 ACAAGGCTGTTAGTGTCTTGAGG + Intergenic
985935577 5:3095184-3095206 GCCTGGCTCTCAGTGTCTTTGGG + Intergenic
986139307 5:5015114-5015136 AATTGGATGTCAGTGTCTTTTGG + Intergenic
986181862 5:5400563-5400585 ACTGCTCTCTCAATGTCTTGGGG - Intergenic
988148491 5:27344071-27344093 AGTTGCATCTCAGTATCTTGTGG - Intergenic
991080840 5:62597405-62597427 AATTGGTTCACAGTGTCTTCAGG + Intronic
991382806 5:66049607-66049629 ACTTTGATCTCAGTGTATTTAGG - Intronic
992616178 5:78548174-78548196 CCTTGGCTCTGAGTGTTTTAAGG + Intronic
994223530 5:97224935-97224957 AATTGGCTGTCAGTGACTTCAGG + Intergenic
994249604 5:97520444-97520466 TCTTGGCTCTCACTGTCATTAGG - Intergenic
997429883 5:133830322-133830344 ACTTGGCTCTCTGTACCTAGGGG + Intergenic
997740439 5:136248261-136248283 AGTTGTCTCTCAGAGTCATGTGG - Intronic
997911545 5:137878922-137878944 CTTTGGCTCCCAGTTTCTTGTGG - Intronic
999268114 5:150280184-150280206 ACGTGGCTCTGAGTGGCTTGGGG - Intronic
1000251026 5:159495771-159495793 ACTCAGCTCTCAGTGACTTTTGG - Intergenic
1000385904 5:160674637-160674659 ACTGGGCTATCTCTGTCTTGGGG - Intronic
1000804289 5:165769796-165769818 CCTTGTCTCTAAGTGTCTTAAGG - Intergenic
1000962243 5:167613646-167613668 ACTTGGCTTTCTGTGACCTGGGG - Intronic
1001903884 5:175454713-175454735 ATTGGGGTCACAGTGTCTTGTGG - Intergenic
1003386728 6:5674657-5674679 CCTAGGCTCTCAGATTCTTGAGG + Intronic
1004246312 6:13979828-13979850 ACTTGTGTCTCCGTGTATTGTGG + Exonic
1005494188 6:26374575-26374597 GCTTGGCTCCCTGTGTCATGGGG - Intronic
1005822810 6:29611697-29611719 ACTCGGCTCTCAGTCTTTTACGG - Intronic
1006056092 6:31385478-31385500 ACGTGGTTCTCAGTGTCCTGTGG + Intergenic
1008487547 6:52052250-52052272 AGTTTGCCCTCAGTGTCTTCAGG - Intronic
1011273407 6:85603362-85603384 CCTTGCCTCCCAGTGTGTTGGGG - Intronic
1012194497 6:96323615-96323637 ACTTGACTTTAAGTGTCTTCAGG - Intergenic
1012744178 6:103062578-103062600 AATTATCTCTCAGTGTCTTTGGG - Intergenic
1014852572 6:126360243-126360265 AATAGGTTCTCAGTGTCTTCTGG + Intergenic
1015027987 6:128560292-128560314 ACTAGGCTGTCAGTTTCTTAAGG - Intergenic
1018323523 6:162638666-162638688 ACTTTGCTCTGAGAGTTTTGGGG - Intronic
1021733252 7:23617953-23617975 ACTTGGCTCTCTGTATCTGTAGG - Intronic
1023109755 7:36797338-36797360 TCTTGACTCCCAGTGTTTTGAGG + Intergenic
1023349780 7:39308948-39308970 ACTTCTCCCTCAGTGTCCTGTGG + Intronic
1023828603 7:44026143-44026165 ACTTGGCTCTCCCTGGCTGGAGG + Intergenic
1024060210 7:45691897-45691919 ACTTGTCTCTCAGGGGGTTGTGG + Intronic
1026386841 7:69858277-69858299 ACCTGGATGTCAGTGCCTTGGGG + Intronic
1026443540 7:70464331-70464353 ACGTTGCTCTGAGTGACTTGGGG - Intronic
1026534724 7:71230248-71230270 AGTTGGCTTTCTGTTTCTTGAGG - Intronic
1028143792 7:87299226-87299248 ACATGTCTCCCATTGTCTTGGGG + Intergenic
1029074641 7:97926094-97926116 ACTTGGCACTCAGGGTCTCCTGG + Intergenic
1029134766 7:98361498-98361520 ACTGGGGTCTGAGTGTTTTGGGG + Intronic
1029738898 7:102480423-102480445 ACTTGGCTCTCCCTGGCTGGAGG + Intergenic
1029756899 7:102579586-102579608 ACTTGGCTCTCCCTGGCTGGAGG + Intronic
1029774838 7:102678646-102678668 ACTTGGCTCTCCCTGGCTGGAGG + Intergenic
1030371425 7:108703855-108703877 ACATGGCTCTTATTATCTTGAGG - Intergenic
1031709359 7:125025475-125025497 ACTTGGCTCTCTCTTTATTGGGG + Intergenic
1032601884 7:133306073-133306095 TCTTTGCTATAAGTGTCTTGTGG + Intronic
1032605770 7:133350132-133350154 ACTTTGTTCTTAGTGTCTTTTGG + Intronic
1034103907 7:148474433-148474455 ACTTAACTGTCAGTGTCCTGTGG - Intergenic
1035230447 7:157462704-157462726 ACTTGGCTGTTGGAGTCTTGCGG - Intergenic
1036278809 8:7380672-7380694 ACATGCCTCCCAGGGTCTTGAGG + Intronic
1036342710 8:7931196-7931218 ACATGCCTCCCAGGGTCTTGAGG - Intronic
1039290439 8:36088850-36088872 AAGTGGCTCTCAGTGTGATGGGG + Intergenic
1039341603 8:36656675-36656697 ACATGGCATTCAGTGTCTAGAGG - Intergenic
1039678692 8:39703625-39703647 ACATGGCTCTTATTGTTTTGAGG + Intronic
1039702392 8:39975340-39975362 GCTTGGCTTTCATTGTCTTTTGG - Intronic
1041401331 8:57448433-57448455 AATTAGCTCTGAGTATCTTGAGG - Intergenic
1041495504 8:58481520-58481542 ACTAGACTCTGAGTGCCTTGAGG + Intergenic
1048028798 8:130611763-130611785 ACTAGAATCTCAATGTCTTGAGG - Intergenic
1050593411 9:7182785-7182807 AATTGGCTCTCTCTGTCTTCTGG + Intergenic
1055161960 9:73141498-73141520 ACTTGGCTCTCAGACTCTTTTGG - Intergenic
1056659109 9:88531954-88531976 ACTTGGGGCTCAGTGTTCTGCGG - Intergenic
1057266527 9:93621354-93621376 TCTTTTCTCTCAGTCTCTTGGGG + Intronic
1058153318 9:101486099-101486121 ACTGCGCTCGCGGTGTCTTGGGG - Intronic
1058187502 9:101872390-101872412 ACTTGGCTCTTATTATTTTGAGG - Intergenic
1059983456 9:119798333-119798355 ACATGGCTCTCAGAGTTTGGAGG + Intergenic
1060396217 9:123318798-123318820 CCTTGGGTCTCAGTTTCTGGAGG + Intergenic
1061174172 9:128982572-128982594 ACTTGGCCCACAGTGCCTTGAGG - Exonic
1061209425 9:129182261-129182283 ACTTAGCTCTCAGTATTTTCTGG - Intergenic
1061506277 9:131033638-131033660 ACTTGGCTGTCAGGGGTTTGGGG - Intronic
1061523426 9:131137035-131137057 CCATGGCTCTCATTGTCTAGGGG + Intronic
1061572117 9:131484328-131484350 ACATGGCTCTCCCTGTCTGGAGG + Intronic
1062391184 9:136334561-136334583 AGATGGCACTCAGTGTCTTCAGG - Exonic
1186598596 X:11011002-11011024 AATTGGCTCTCAATCTCATGAGG + Intergenic
1187709509 X:22039583-22039605 CCTTTTCTCTCACTGTCTTGAGG - Intronic
1187856000 X:23636761-23636783 ACTTGGCTCCCTTTGTCTTTGGG - Intergenic
1193443276 X:81568312-81568334 ACATGGCTTTCAGAGGCTTGAGG + Intergenic
1193479536 X:82010490-82010512 ACTTGGCTATCATTGTGTGGGGG + Intergenic
1194015408 X:88613272-88613294 ATTTGTCTCTCACTGTCTTCAGG - Intergenic
1194553624 X:95331383-95331405 ACCAGGCTCCCAGTGTCATGGGG + Intergenic
1197826714 X:130597959-130597981 ACTCAGCTCTCAGTCTTTTGGGG - Intergenic
1200084399 X:153596342-153596364 ACTGGGCTCTCAGACTCTAGTGG + Intronic
1200228401 X:154431996-154432018 ACTTGGGTCTGAGTCTCTTCTGG + Intronic