ID: 933625663

View in Genome Browser
Species Human (GRCh38)
Location 2:84595843-84595865
Sequence ATGCTAATGAGACCAAAATC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 184
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 171}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933625662_933625663 -5 Left 933625662 2:84595825-84595847 CCAGTTGGTTATTAATTGATGCT 0: 1
1: 0
2: 0
3: 8
4: 126
Right 933625663 2:84595843-84595865 ATGCTAATGAGACCAAAATCAGG 0: 1
1: 0
2: 1
3: 11
4: 171

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933625663 Original CRISPR ATGCTAATGAGACCAAAATC AGG Intronic
903436966 1:23357312-23357334 AGGCTGATGACACCAAAATCTGG - Intergenic
908182827 1:61622982-61623004 ATGCAAAAAAGACCAAAAGCAGG - Intergenic
908660426 1:66429180-66429202 AGGCAAATGAAACAAAAATCTGG - Intergenic
910385414 1:86677419-86677441 ATGAAACTGATACCAAAATCTGG + Intergenic
911171876 1:94778432-94778454 ATTCTAATAAGACCAACATATGG + Intergenic
915085146 1:153381798-153381820 ATCCTCATGACACCAAAATTTGG + Intergenic
916635351 1:166662256-166662278 ATGCTAAAGAGCCCCAAAGCGGG + Intergenic
916964362 1:169919942-169919964 ATACTAATGAAAACAAAATTAGG + Intergenic
920973437 1:210762883-210762905 ATCATCATGATACCAAAATCTGG + Intronic
921391538 1:214619826-214619848 ATCCTAATGACATCAAAATGAGG - Intronic
923795503 1:237150813-237150835 AAGCTTTTGAAACCAAAATCTGG - Intronic
923838371 1:237640292-237640314 TTGCTGATGAGAGCCAAATCTGG - Intronic
1063094985 10:2901122-2901144 ATGTTAATGAGACAAAACTTAGG - Intergenic
1064476855 10:15699872-15699894 ATGCAAATGAAAACAAAATGAGG - Intronic
1064977250 10:21130938-21130960 ATGTCAATGAAACCAAAAACTGG + Intronic
1065058973 10:21877596-21877618 ATGCAAATTAGACCAAAATTAGG + Intronic
1073761035 10:106629052-106629074 ATGATTAAGAGACCAAAATAAGG - Intronic
1075852946 10:125603577-125603599 ATGCAAATGATGGCAAAATCTGG + Intronic
1078220508 11:9347965-9347987 ATGCTAATTAGGCAAAAAACGGG - Intergenic
1078902749 11:15656509-15656531 CTGCTAATAAGAGCAAAGTCAGG + Intergenic
1079365984 11:19810402-19810424 ATGCTATTGAAACCAAGATCAGG + Intronic
1079395326 11:20057355-20057377 ATGCAAATGATACATAAATCAGG - Intronic
1079776069 11:24529556-24529578 ATGCTAATGTGTCCATGATCAGG + Intronic
1080016746 11:27515548-27515570 AAGATGATGAAACCAAAATCTGG + Intergenic
1081299447 11:41432771-41432793 GGTGTAATGAGACCAAAATCAGG + Intronic
1081319788 11:41677545-41677567 ATTCTAATGAAAGCAAAACCAGG + Intergenic
1085023850 11:73225263-73225285 AGGCTAGTGAGGCCAAAGTCAGG - Intronic
1085997592 11:81938831-81938853 ACTCGAATGTGACCAAAATCAGG + Intergenic
1087424677 11:97971505-97971527 ATGGTATTGAGACCAAAATCTGG + Intergenic
1093533637 12:20197482-20197504 ATTCTCCTGATACCAAAATCAGG - Intergenic
1099130852 12:78828873-78828895 ATCATAATGATACCAAAACCTGG - Intergenic
1099467627 12:83006311-83006333 AAGCGAGTGAGACCAAAATATGG - Intronic
1101187791 12:102298198-102298220 ATCATCATGACACCAAAATCAGG - Intergenic
1103176103 12:118864833-118864855 GGGCTGATGAGACCAATATCAGG + Intergenic
1107708856 13:43133086-43133108 GTGCTAATGAGGCCAAAGCCTGG + Intergenic
1108212394 13:48151478-48151500 AGCCTAATGAGACCCACATCAGG + Intergenic
1108452385 13:50580144-50580166 ATGCTGATGATACCATAACCAGG - Intronic
1108874852 13:55033382-55033404 ATGCTAATGAGTACATATTCTGG + Intergenic
1109476920 13:62891477-62891499 TTGTTTATAAGACCAAAATCTGG + Intergenic
1110474123 13:75893417-75893439 ATGCTAATGAGAAACAAAGCGGG + Intergenic
1111908076 13:94278917-94278939 ATCATACTGATACCAAAATCTGG - Intronic
1112545316 13:100362757-100362779 ATGCTAATAACACCAAACTTGGG + Intronic
1113464856 13:110505965-110505987 ATGCTACTGAGAACAAAGTGTGG + Intronic
1115001715 14:28429284-28429306 ATGCAGATGAAACCAAAATTAGG - Intergenic
1115002166 14:28436005-28436027 ATTATAATGAGACTATAATCAGG - Intergenic
1116321138 14:43464729-43464751 ATTCTTCTGATACCAAAATCAGG - Intergenic
1117362884 14:54995301-54995323 AAGTCAATGAGACCAAAAGCTGG - Intronic
1118861164 14:69664846-69664868 ATGCTAATAAAACAAAAATTAGG + Intronic
1120455344 14:84723108-84723130 ATGCTGAACAGACCAATATCAGG + Intergenic
1121748079 14:96318515-96318537 TTGCTGATGAGAGAAAAATCAGG - Intronic
1126275757 15:46878696-46878718 AAGCTATTGAGACAAAAAGCTGG + Intergenic
1126461107 15:48915824-48915846 GTGCTAAGGAGAAAAAAATCAGG - Intronic
1127741954 15:61917193-61917215 ATGTTAATGATAGCAAAAACTGG - Intronic
1133818165 16:9213929-9213951 AGCCTCATGAGGCCAAAATCAGG + Intergenic
1133911091 16:10067467-10067489 ATGCCAATGACACGAACATCAGG + Intronic
1134281770 16:12823228-12823250 ATGGAAATAATACCAAAATCAGG + Intergenic
1137260911 16:46829471-46829493 ATGCCAATTAGAACAAAGTCAGG + Intronic
1137687743 16:50398541-50398563 AGGCCAATGAGACCCAACTCTGG - Intergenic
1138253786 16:55533159-55533181 ATTCTAATGAGACCCTAATCTGG - Intronic
1138721410 16:59085843-59085865 AAAACAATGAGACCAAAATCTGG - Intergenic
1139040280 16:62991921-62991943 ATACTACTGAAACCCAAATCAGG + Intergenic
1140301248 16:73759409-73759431 ATGGTCATGTGACTAAAATCTGG - Intergenic
1140964570 16:79952545-79952567 ATGCTCATGAATCAAAAATCGGG - Intergenic
1150674121 17:67229658-67229680 ATGCTAATGAGAACTGAATTTGG - Intronic
1150939044 17:69670272-69670294 ATGAGTATGAGACAAAAATCAGG + Intergenic
1154033056 18:10770425-10770447 ATTCTAAGAAAACCAAAATCTGG + Intronic
1155421571 18:25662268-25662290 ATCTTAATGAGACCAAATTTGGG + Intergenic
1156055360 18:32996302-32996324 ATATTAATAATACCAAAATCAGG - Intronic
1156863136 18:41861559-41861581 ATCCAAAAAAGACCAAAATCAGG + Intergenic
1157568393 18:48696108-48696130 ATGCTAATGAGACTGACAGCTGG - Intronic
1162181442 19:8871734-8871756 CTGTCAATGAGACCAAAATATGG - Intronic
1165326200 19:35115814-35115836 ATGCTAGCGTGACCAAAGTCAGG - Intergenic
1165419134 19:35714364-35714386 ATGGAAATCAGACCAAATTCAGG - Intronic
927579079 2:24225294-24225316 TTGCCAATGAGACCAAAGGCAGG - Intronic
928001213 2:27524394-27524416 ATCCTCATAAAACCAAAATCTGG - Intergenic
928831359 2:35488995-35489017 AAGTTAATGAAACCAAAAGCAGG + Intergenic
932111611 2:69006768-69006790 GTGGCAATGAGACCAAGATCTGG - Intergenic
933556374 2:83835665-83835687 ATGCTAATTAGGCAAAAAGCAGG - Intergenic
933625663 2:84595843-84595865 ATGCTAATGAGACCAAAATCAGG + Intronic
936471653 2:112804119-112804141 ATGCTAATGAGTGCAAAATGAGG - Intergenic
936998876 2:118443577-118443599 ATGCTAATGAGACCAGCAGTTGG + Intergenic
937148578 2:119669572-119669594 CTGCATTTGAGACCAAAATCTGG - Intergenic
940469322 2:154074597-154074619 ATTCTCTTGATACCAAAATCTGG + Intronic
943089727 2:183359564-183359586 ATGAAAAGGAGACCAAAATGAGG + Intergenic
943147679 2:184065932-184065954 GTGCTAAGGAGACCAAAGTTTGG - Intergenic
944097678 2:195987607-195987629 ATGGTAATTACACCAAAATATGG - Intronic
945206084 2:207334057-207334079 GTTCTAATGAGACCAATATCAGG + Intergenic
945256594 2:207808277-207808299 ATGCTAATGAGCACATAATGAGG + Intergenic
945345360 2:208707165-208707187 ATGCTAATAACACCAAATGCTGG - Intronic
947035929 2:225854887-225854909 AAGCTAATGAAACAAAAAGCAGG - Intergenic
947612272 2:231531474-231531496 AGGCTAAGGAGACAAAACTCTGG - Intergenic
1168849741 20:968294-968316 ATGGTCATGTGACCAACATCTGG + Intronic
1170208953 20:13828916-13828938 ACACTAATGAGACCTAAATAGGG + Intergenic
1170583964 20:17720043-17720065 ATGCTAATGAAATCAAACTCTGG + Intronic
1171512295 20:25695995-25696017 TTGCTAATGACGGCAAAATCCGG - Intronic
1171747944 20:29017907-29017929 ATGATCTTGACACCAAAATCTGG + Intergenic
1177928369 21:27248438-27248460 TTGCAAATGAATCCAAAATCTGG - Intergenic
1177928783 21:27252919-27252941 TTGATAATGTCACCAAAATCTGG + Intergenic
1178215930 21:30598318-30598340 ATACTAATGAAAAGAAAATCAGG + Intergenic
1178545387 21:33489284-33489306 TTTCTAATGATACCAAAATATGG + Exonic
1178987333 21:37318086-37318108 ATAATAATGATACCAAATTCTGG + Intergenic
1179128284 21:38611664-38611686 ATGCTAAGGAGAGAAAAATGAGG - Intronic
1179256273 21:39718830-39718852 ATCATATTGATACCAAAATCTGG - Intergenic
1182874203 22:33676205-33676227 ACCCTAAAGAGACCAAATTCTGG + Intronic
1182875600 22:33688727-33688749 TTGCAAAGGAGACCAAGATCTGG - Intronic
1184318934 22:43724004-43724026 ATGTTCATGAGAACAAAATAAGG - Intronic
951981043 3:28567596-28567618 ATGCTAATGAGAACCAGGTCAGG + Intergenic
956311568 3:67886590-67886612 TTCCTAATGTGACCAAAACCTGG + Intergenic
957189540 3:76989381-76989403 ATGCTCATTAGACCATAATAGGG - Intronic
961207706 3:125099573-125099595 ATGTTAATGAGAAAAAAATTCGG + Intronic
963126474 3:141821348-141821370 ATGCTAATTAGACAAAAAACAGG + Intergenic
964050200 3:152382789-152382811 ATGCTAAAGATAACAAAAACTGG - Intronic
964219074 3:154323973-154323995 ATGCTCATCTGACCAAAAACAGG - Intronic
966018449 3:175174265-175174287 ATGGTAATGAGAACAAGAGCTGG - Intronic
966774483 3:183531912-183531934 ATGATATTCAGACCATAATCTGG + Intronic
967366774 3:188695783-188695805 GTGCTAATTAGACCAGAAGCTGG - Intronic
967517599 3:190388536-190388558 AGGCTAATGATACCAAAAATAGG + Intronic
970458759 4:16251964-16251986 ATCTTAATGAGACCAATGTCAGG + Intergenic
971601280 4:28595249-28595271 GTGCTAATGAAAGCAACATCTGG + Intergenic
971734219 4:30425363-30425385 ATCATCCTGAGACCAAAATCGGG + Intergenic
972638100 4:40902115-40902137 ATGTTGATGAGAAAAAAATCTGG + Intronic
973000581 4:44944163-44944185 AGGCTAAGGAGTCCAAGATCAGG + Intergenic
973092104 4:46149395-46149417 ATGCAAATGATTCAAAAATCGGG + Intergenic
973205105 4:47551080-47551102 ATGCTAATTAGGCAAAAAACAGG - Intronic
973945978 4:55956234-55956256 ATTCTAATGAGACAAAATTGTGG + Intronic
976079616 4:81340810-81340832 ATCATACTGATACCAAAATCTGG - Intergenic
977142273 4:93388366-93388388 ATGCCAATGAAATCAGAATCTGG - Intronic
977168766 4:93733768-93733790 ATGCTAATGACACTAATATTAGG + Intronic
977442216 4:97082588-97082610 ATCATTATGATACCAAAATCTGG - Intergenic
981408403 4:144398502-144398524 AAATTAATGAAACCAAAATCTGG + Intergenic
982859522 4:160431471-160431493 ATCATAATGATACCAAAACCTGG - Intergenic
983365246 4:166778382-166778404 ATTCAAATGAAAGCAAAATCTGG + Intronic
988585502 5:32504258-32504280 ATGCTAATGAGTGCATAATGAGG - Intergenic
988803125 5:34715309-34715331 ATGCTAATGAGTGCATAATGAGG + Intronic
996143394 5:119943116-119943138 ATTCTAATGAGACTACAATCTGG - Intergenic
996211287 5:120814211-120814233 ATCATACTGATACCAAAATCAGG - Intergenic
996259160 5:121444977-121444999 ATTCTCATGAGACCAATTTCTGG - Intergenic
996808135 5:127481375-127481397 ATGCTGGGGAGCCCAAAATCAGG + Intergenic
997024034 5:130036920-130036942 ATGCTAAGTAGACTGAAATCTGG + Intronic
998635309 5:143948212-143948234 ATGCTAATGAGTCATAAATTTGG + Intergenic
998968684 5:147567998-147568020 GTGCTAATGAGACCACAGCCAGG - Intergenic
1000650274 5:163809379-163809401 ATGCTATTGAGAGAAAAACCAGG + Intergenic
1002980740 6:2134474-2134496 GTGCTATTGAGACCAAGATGTGG - Intronic
1005881185 6:30062020-30062042 AAGCTAATGAGATCAAGAACTGG + Intronic
1009535159 6:64872986-64873008 ATGCTAAAGAGACTAAAACAAGG + Intronic
1011324204 6:86130790-86130812 TTGCTAATGAGAACAACCTCCGG + Intergenic
1011907031 6:92384053-92384075 ATTTAAATGACACCAAAATCAGG + Intergenic
1012226526 6:96710040-96710062 GTGCTAAGCAGACCAAAATTGGG + Intergenic
1012558255 6:100544362-100544384 AAACAAATGAGACCAAAAGCCGG + Intronic
1013609039 6:111776876-111776898 TTGCTAGTGACACCACAATCTGG - Intronic
1015356660 6:132285551-132285573 ATACTAATGAAATCAAAATATGG - Intergenic
1021331296 7:19341979-19342001 ATACTAATGTGATCAAAATTTGG + Intergenic
1021370725 7:19842631-19842653 ATGCTACTGGGAGAAAAATCTGG + Intergenic
1021535661 7:21701588-21701610 ATGCAAATGAGAGCAAAAAGTGG - Intronic
1028536409 7:91892646-91892668 ATGAAAATCAGACCAATATCTGG - Intergenic
1028744556 7:94312578-94312600 GTGCATATGAGACCAACATCTGG - Intergenic
1031243510 7:119276085-119276107 ATGATAATGATGTCAAAATCTGG + Intergenic
1031641147 7:124165531-124165553 ATGATGTTGATACCAAAATCTGG + Intergenic
1032520853 7:132543824-132543846 AGGGGCATGAGACCAAAATCAGG + Intronic
1035592373 8:825664-825686 AAATCAATGAGACCAAAATCTGG - Intergenic
1037734722 8:21556774-21556796 ACGCGAAAGAGCCCAAAATCGGG + Intergenic
1038215381 8:25557288-25557310 ATTCTATTTACACCAAAATCAGG - Intergenic
1039540693 8:38365761-38365783 AAACTAATGAAACCAAAACCAGG + Intronic
1042121247 8:65490748-65490770 ATTCAAATGAGACCAAAAACTGG + Intergenic
1045173903 8:99699404-99699426 ATCCTAATGAGTCCATAATATGG + Intronic
1050481714 9:6094875-6094897 ATGATCCTGATACCAAAATCTGG - Intergenic
1051701795 9:19832179-19832201 CTGCTCACCAGACCAAAATCTGG - Intergenic
1055324721 9:75117442-75117464 ATGCTATTAAGAGCAAATTCAGG + Intronic
1055761706 9:79616117-79616139 CTGCAAATGAGACCGAAATAGGG - Intronic
1057319229 9:93996995-93997017 ATTCCAGTGAGACCAAATTCTGG + Intergenic
1187405192 X:18997349-18997371 ATTCTAATGAGAAGATAATCTGG + Intronic
1187803979 X:23097710-23097732 ATCCTACTGATACCAAAATCTGG + Intergenic
1188563148 X:31493143-31493165 AGGCTATTGAGACCAAGAGCAGG - Intronic
1189265278 X:39710973-39710995 ATGCAAATGAGACTAGAAGCAGG + Intergenic
1190519380 X:51261869-51261891 TGTCTAATGAGACCAACATCTGG - Intergenic
1193791269 X:85818102-85818124 ATGCTTATGTGAACAAAATTTGG + Intergenic
1195692918 X:107643498-107643520 ATGATAATGAAAAAAAAATCAGG - Intronic
1195930881 X:110074176-110074198 ATGCAAATCAAACCACAATCAGG - Intronic
1196287314 X:113897713-113897735 ATGCTAATTAGGCAAAAAACAGG - Intergenic
1197390981 X:125864100-125864122 ATGATCTTGATACCAAAATCTGG + Intergenic
1197600922 X:128528610-128528632 ATTATCATGACACCAAAATCTGG + Intergenic
1198056664 X:133002496-133002518 ATGGTTATGAGACCAAATTTAGG - Intergenic
1198776399 X:140184075-140184097 AAGCTAATGAGGCCAAGGTCAGG + Intergenic
1200426411 Y:3025538-3025560 AACCTAATGAAACCAAAAGCTGG - Intergenic