ID: 933627740

View in Genome Browser
Species Human (GRCh38)
Location 2:84620791-84620813
Sequence TTCCAATGGCTTGACTGTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 138}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933627740_933627745 30 Left 933627740 2:84620791-84620813 CCATGACAGTCAAGCCATTGGAA 0: 1
1: 0
2: 0
3: 6
4: 138
Right 933627745 2:84620844-84620866 GTCATTTGGACTTTTCAGTTGGG 0: 1
1: 0
2: 1
3: 8
4: 206
933627740_933627744 29 Left 933627740 2:84620791-84620813 CCATGACAGTCAAGCCATTGGAA 0: 1
1: 0
2: 0
3: 6
4: 138
Right 933627744 2:84620843-84620865 TGTCATTTGGACTTTTCAGTTGG 0: 1
1: 0
2: 1
3: 20
4: 266
933627740_933627743 16 Left 933627740 2:84620791-84620813 CCATGACAGTCAAGCCATTGGAA 0: 1
1: 0
2: 0
3: 6
4: 138
Right 933627743 2:84620830-84620852 ACAAGAACTGAAGTGTCATTTGG 0: 1
1: 0
2: 0
3: 15
4: 190

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933627740 Original CRISPR TTCCAATGGCTTGACTGTCA TGG (reversed) Intronic