ID: 933627740 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 2:84620791-84620813 |
Sequence | TTCCAATGGCTTGACTGTCA TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 145 | |||
Summary | {0: 1, 1: 0, 2: 0, 3: 6, 4: 138} |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
933627740_933627745 | 30 | Left | 933627740 | 2:84620791-84620813 | CCATGACAGTCAAGCCATTGGAA | 0: 1 1: 0 2: 0 3: 6 4: 138 |
||
Right | 933627745 | 2:84620844-84620866 | GTCATTTGGACTTTTCAGTTGGG | 0: 1 1: 0 2: 1 3: 8 4: 206 |
||||
933627740_933627744 | 29 | Left | 933627740 | 2:84620791-84620813 | CCATGACAGTCAAGCCATTGGAA | 0: 1 1: 0 2: 0 3: 6 4: 138 |
||
Right | 933627744 | 2:84620843-84620865 | TGTCATTTGGACTTTTCAGTTGG | 0: 1 1: 0 2: 1 3: 20 4: 266 |
||||
933627740_933627743 | 16 | Left | 933627740 | 2:84620791-84620813 | CCATGACAGTCAAGCCATTGGAA | 0: 1 1: 0 2: 0 3: 6 4: 138 |
||
Right | 933627743 | 2:84620830-84620852 | ACAAGAACTGAAGTGTCATTTGG | 0: 1 1: 0 2: 0 3: 15 4: 190 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
933627740 | Original CRISPR | TTCCAATGGCTTGACTGTCA TGG (reversed) | Intronic | ||