ID: 933628967

View in Genome Browser
Species Human (GRCh38)
Location 2:84634955-84634977
Sequence CATTGTGACCAGATCTCCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 159
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 145}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933628967 Original CRISPR CATTGTGACCAGATCTCCAA AGG (reversed) Intronic
901248435 1:7752705-7752727 CATGGTTACCAGCACTCCAAGGG - Intronic
908126158 1:61032104-61032126 CATTGTGACATGCTTTCCAAAGG - Intronic
913682085 1:121195528-121195550 CATTCTGAGTAGATCTCCAGTGG - Intronic
914033922 1:143983152-143983174 CATTCTGAGTAGATCTCCAGTGG - Intergenic
914155526 1:145084820-145084842 CATTCTGAGTAGATCTCCAGTGG + Intronic
918893928 1:190315368-190315390 CTCTGTGACCATATCTGCAATGG - Intronic
918970093 1:191403361-191403383 CATTGGGAACAGATCTGAAAAGG + Intergenic
919574549 1:199291700-199291722 CATTGTATGCAAATCTCCAAGGG + Intergenic
920469398 1:206214037-206214059 CATTCTGAGTAGATCTCCAGTGG - Intronic
920731487 1:208489496-208489518 CATTGTGAACTGGTCCCCAAAGG + Intergenic
923565122 1:235070676-235070698 CATTGTGACCAGTTTTTCCATGG - Intergenic
923581192 1:235215595-235215617 CAGTGAGACCATGTCTCCAAGGG - Intronic
1063497224 10:6521034-6521056 CAAGCTGACCACATCTCCAAAGG - Intronic
1064194776 10:13235753-13235775 CATTAGGAACACATCTCCAAGGG - Intergenic
1064993043 10:21273305-21273327 CTTGGAGACCAGCTCTCCAAGGG - Intergenic
1067151971 10:43743305-43743327 CATTGTCACCACATCTCTAATGG + Intergenic
1067992994 10:51236918-51236940 CCTTGTGACCAGAACTCTACTGG - Intronic
1069788819 10:71006418-71006440 CATTGTCACCCCATCTCCCACGG + Intergenic
1069894434 10:71671858-71671880 AATTTTGACCAGAACTCCACAGG - Intronic
1069896329 10:71682468-71682490 GATTATGAACAGATATCCAATGG + Intronic
1074673783 10:115825600-115825622 CAGTGTGGACAGATCTCAAAGGG - Intronic
1076324097 10:129607708-129607730 CATGGTGAGCAGCTGTCCAAGGG - Intronic
1077484673 11:2833268-2833290 CATTGTGTCCAGAAGTCCACAGG - Intronic
1079338085 11:19588979-19589001 CTCTGTGCCCAGATCTCCATGGG - Intronic
1079470220 11:20770933-20770955 CATTGTAGCCAGATCTGCACTGG + Intronic
1080164118 11:29216168-29216190 CATACTGACCAGATCTCATAAGG + Intergenic
1084118590 11:67056163-67056185 CAGTGTGATCAGAACTACAACGG - Intergenic
1084844256 11:71887105-71887127 CATTGTGACCAGAGGCTCAATGG - Intronic
1085702848 11:78760513-78760535 CATTGTCACAAGACATCCAAGGG - Intronic
1086539270 11:87888293-87888315 CATTGTGAGCATATCTGAAATGG - Intergenic
1086824129 11:91475021-91475043 CATTATGAGCAGATCTTCGAAGG + Intergenic
1092211980 12:6652299-6652321 CTTTGTCACCAGGTCTCCTATGG - Exonic
1094772536 12:33681599-33681621 CATTGTTTCCAGATCTCAATTGG + Intergenic
1097151519 12:56982975-56982997 CATTGTTGCCAGTTCTCAAAGGG - Intergenic
1101824758 12:108211351-108211373 CATTTTAACAAGATCTCCCAGGG - Intronic
1102441604 12:112967933-112967955 CAGTGTACCAAGATCTCCAAGGG + Exonic
1105985009 13:25557277-25557299 CTTTGTGACCAGAGCCCCAAAGG - Intronic
1108514128 13:51181915-51181937 CATTGGGACCAGGTTTCCCATGG + Intergenic
1109560033 13:64034593-64034615 CATTGTGGCCAGAGCTTCATAGG + Intergenic
1110168425 13:72471471-72471493 CATTCTTACCAGAGCACCAATGG + Intergenic
1113389649 13:109883210-109883232 CATTTTAACCAGATCCCCAGGGG - Intergenic
1114391533 14:22314022-22314044 CATTGTGACCAAATGCCGAATGG - Intergenic
1114953369 14:27785552-27785574 CATTGGGATAAGTTCTCCAAAGG + Intergenic
1122763827 14:104050710-104050732 CATTGTGTGCAGAGCTCCATGGG + Intronic
1124881009 15:33642636-33642658 CACTGTAATCAGATTTCCAAAGG + Intronic
1126380943 15:48046270-48046292 TATTGTGTCCAGATTACCAAAGG - Intergenic
1127522663 15:59758528-59758550 TATTGTGACCAGTTCTCCAGTGG - Intergenic
1133107535 16:3522548-3522570 CATTGAGACCCCATCTCTAAAGG - Intronic
1135502850 16:23012246-23012268 CACTGTGACCAGGTGTTCAAGGG - Intergenic
1138873197 16:60917752-60917774 CATTCTGACCTCATCTCCATAGG + Intergenic
1140959347 16:79897210-79897232 CATTGTGACCCTAGCTGCAAAGG + Intergenic
1145210469 17:21009404-21009426 CTTTGTGATCTGCTCTCCAAAGG + Intronic
1146404858 17:32528280-32528302 CCTTGCTACCAGCTCTCCAAAGG - Intronic
1147190964 17:38737964-38737986 CATTTTAACAAGATCTCCAGGGG + Intronic
1149268017 17:54948641-54948663 AAATGTGAACAGATATCCAATGG - Intronic
1151390651 17:73784696-73784718 CATTTTAACCAGATCGCCAGGGG - Intergenic
1151509367 17:74548853-74548875 CATTGTTCCCTGATCTCCACAGG - Intergenic
1153181033 18:2433628-2433650 CATTATGAACAGATCTATAAAGG + Intergenic
1155423507 18:25681454-25681476 CATTGTGACCTCATTTCCATAGG + Intergenic
1156071899 18:33221547-33221569 CACTGTGACCAGAACTGTAATGG - Intronic
1157559375 18:48635926-48635948 CATTTTGACGAGCTCCCCAAGGG - Intronic
1157985848 18:52436537-52436559 CATTGTAACAAGATTTCCAGGGG + Intronic
1160416541 18:78715977-78715999 TCTTGTGACCAGTTCACCAAAGG + Intergenic
1161199781 19:3008231-3008253 CACTGTGGCCAGATCTCCTCTGG + Intronic
1161505929 19:4643467-4643489 CACTGTGGCCAGATTTCCACTGG - Intronic
927432735 2:23040750-23040772 CATTGTGACCACATCTCTTATGG + Intergenic
927672913 2:25083878-25083900 CATTTTAACCAGATCCCCAAGGG + Intronic
928766441 2:34651821-34651843 CAGTATTAGCAGATCTCCAATGG - Intergenic
929238060 2:39627128-39627150 CATTGTGGCAACATCTCCAAGGG + Intergenic
930394710 2:50806599-50806621 CAGTGTGACCATATCTCTAAGGG - Intronic
930524056 2:52504253-52504275 CATTTTGACCAAATCTACACAGG - Intergenic
932033645 2:68217091-68217113 CAGTGTGAGCACATTTCCAAAGG + Exonic
932601438 2:73129292-73129314 GATTGTGATCAGCTGTCCAAGGG - Intronic
932671617 2:73742103-73742125 CATTGTGAGCCAATCTCCCAAGG + Intergenic
933628967 2:84634955-84634977 CATTGTGACCAGATCTCCAAAGG - Intronic
934483950 2:94683898-94683920 CATTGGGATAAGGTCTCCAAAGG - Intergenic
935356773 2:102208643-102208665 CATGCTGACCAGATCCCCATAGG - Intronic
935495539 2:103776432-103776454 CACTGTGATGAGTTCTCCAAAGG + Intergenic
937973868 2:127569363-127569385 CATTTTCACCAGATCCCCAGAGG - Intronic
938804221 2:134791219-134791241 CACTGTGACTAAATCTCAAAGGG - Intergenic
942610253 2:177735908-177735930 AATTGGGACCAGAGCTTCAAAGG - Intronic
943643223 2:190381669-190381691 CTATGTGACCAGAACTGCAAGGG - Intergenic
947389419 2:229623750-229623772 CAGTGGGACCAGATATCCATAGG - Intronic
1170029858 20:11933333-11933355 TTTTGTGACCATATCACCAAGGG + Intergenic
1171124620 20:22590827-22590849 CATTTTAACAAGATCACCAAGGG - Intergenic
1172179117 20:32989907-32989929 CACTGTGACCAGATGTCATATGG + Intronic
1173390825 20:42631082-42631104 CATATTGACAAGATCTGCAATGG + Intronic
1174098940 20:48112213-48112235 AATTGTGGCCAGAATTCCAATGG - Intergenic
1176873881 21:14106790-14106812 GATTGTGAGCAGATGCCCAAGGG + Intergenic
1182726871 22:32454384-32454406 CATTTTGACCAGATTGTCAAAGG + Intronic
1184770234 22:46592683-46592705 TATGGTGACCAGCTCTGCAAGGG + Intronic
951560583 3:23962224-23962246 CATGGTGACCAGAGCTCACAAGG + Exonic
952414602 3:33079706-33079728 CATTGTGAAATGATCTCCGATGG + Intronic
953822091 3:46215563-46215585 CATTTTTATCAGATCCCCAAGGG + Intronic
960461631 3:117942980-117943002 CATTGTGATAAGATCTCAGATGG + Intergenic
965534127 3:169807264-169807286 CATTGAGACCAAATCCACAATGG + Intronic
967414142 3:189198093-189198115 AACTGTAACCAGATCTTCAAGGG + Intronic
967804116 3:193699189-193699211 CACTGTGACTAGATCTTCAGGGG - Intergenic
971119951 4:23692332-23692354 CATAGTGAGAAGATCTCTAAAGG + Intergenic
973221489 4:47731958-47731980 CTTTGTCCCCACATCTCCAAGGG - Intronic
974324080 4:60391547-60391569 GAATGTGAACAGTTCTCCAAAGG - Intergenic
979654208 4:123173130-123173152 CATTGTTACCAGATTTTCAGGGG + Intronic
983194537 4:164792092-164792114 CATTTTAACAAGATCTTCAAGGG - Intergenic
983436636 4:167724024-167724046 CATTGTTTCTATATCTCCAAAGG + Intergenic
985315843 4:188658469-188658491 CATAGTGACCAGATTTGCAGAGG + Intergenic
990205893 5:53429274-53429296 ATTTTTGTCCAGATCTCCAAGGG + Intergenic
990332480 5:54741248-54741270 CAATGTGAGCAGATGTGCAAAGG + Intergenic
990636470 5:57733468-57733490 GATGGTGACAAGATCCCCAATGG - Intergenic
997787230 5:136724596-136724618 CATTTTCAGCAAATCTCCAAAGG + Intergenic
1000306496 5:159999643-159999665 TATTGTGACCACAACACCAAGGG + Intergenic
1000965610 5:167652531-167652553 CATACTGACCAGATATTCAAGGG - Intronic
1004298656 6:14437259-14437281 CTTTGTCACCAGTTTTCCAATGG - Intergenic
1007500221 6:42291240-42291262 CATGCTGAACAGATCTGCAATGG - Intronic
1008449616 6:51635535-51635557 CATTGAGACCAAAGTTCCAAAGG - Intronic
1011323931 6:86128630-86128652 AATTGTGATCTGATCTCTAATGG + Intergenic
1013652595 6:112211087-112211109 CATTTTCACCAGATCTCCAGGGG - Intronic
1014116374 6:117672868-117672890 CATAATGACCATATCTCCCAAGG + Intergenic
1017342761 6:153345266-153345288 CATTGTTTCCAGATCTCAAATGG + Intergenic
1017931614 6:158960281-158960303 CATTCTGACAAGGTCTCAAATGG - Intergenic
1019269959 7:141464-141486 CACTGTGACCCGAACTCAAAGGG + Intergenic
1020099644 7:5387967-5387989 CATGGTGCCCAAACCTCCAAAGG + Exonic
1024060825 7:45697302-45697324 CACTGAGAGCAGATCTCCCAGGG + Intronic
1024911021 7:54447474-54447496 CTTTATGACCAAGTCTCCAAAGG + Intergenic
1027638387 7:80703859-80703881 CATAATGACCAGTGCTCCAAAGG - Intergenic
1029133339 7:98350326-98350348 CATGGTTACAAGATATCCAAAGG + Intronic
1029306765 7:99625367-99625389 CATAGTGACCAGAACAGCAATGG - Intronic
1030098792 7:105926106-105926128 CATTCAGCCCAGATCTCCAAAGG - Intronic
1031845356 7:126799215-126799237 CATTTTGACAAGATCCCCATAGG + Intronic
1032440756 7:131941384-131941406 CATTGTGGCCAAGTCCCCAAGGG + Intergenic
1032891248 7:136197941-136197963 CATTGTGAGGAGAGCACCAAGGG + Intergenic
1035970690 8:4244848-4244870 CATTGTAACAAGATCCCCTAGGG + Intronic
1042189061 8:66167138-66167160 CATAGAGACCAGAAGTCCAAAGG - Intronic
1043012900 8:74902403-74902425 AGTTGTTACAAGATCTCCAAAGG - Intergenic
1044244460 8:89926016-89926038 CATTTTAACAAGATCCCCAAGGG + Exonic
1046988678 8:120423310-120423332 TATTATAACCAGATTTCCAAAGG + Intronic
1050105877 9:2166248-2166270 CATGGCGCCCAGAACTCCAATGG + Intronic
1051097064 9:13477917-13477939 CACTGTGAGCAGATCTTCAGAGG - Intergenic
1053532851 9:38899051-38899073 CAGTGTGAACAAATCTCCCAGGG - Intergenic
1053923637 9:43026858-43026880 CATTGGGATAAGGTCTCCAAAGG + Intergenic
1054205077 9:62123480-62123502 CATTGTGAACAAATCTCCCAGGG - Intergenic
1054384936 9:64540556-64540578 CATTGGGATAAGGTCTCCAAAGG + Intergenic
1054633282 9:67464890-67464912 CATTGTGAACAAATCTCCCAGGG + Intergenic
1056076269 9:83044161-83044183 CATTGTGCCAAGAAGTCCAAAGG - Intronic
1056530871 9:87486469-87486491 CATTGTGAGCTCATCTTCAATGG + Intergenic
1057151365 9:92798849-92798871 CATGGTGAACAAATCTCCCAGGG + Intergenic
1057424143 9:94935115-94935137 TATTGTGACCACAGCACCAAGGG - Intronic
1057942736 9:99299073-99299095 CATTTTGAGCAAATTTCCAAGGG + Intergenic
1058697290 9:107570285-107570307 CATTGGGACCAGAGATTCAAAGG - Intergenic
1059362113 9:113752945-113752967 AATTGTGACAAGAGCTACAAAGG - Intergenic
1060161134 9:121365894-121365916 CATAGTGCCCAGATCCCAAAAGG - Intronic
1060338837 9:122754355-122754377 CAATGTGACAAGATGTCCAGAGG - Intergenic
1061705230 9:132447976-132447998 CATTGTCACCACATTACCAATGG - Intronic
1062124629 9:134853360-134853382 CAGTATGGCCAGGTCTCCAAAGG + Intergenic
1188604821 X:32015432-32015454 TGTTGTGACCAGCTCTCCAGGGG - Intronic
1189698019 X:43685750-43685772 CATTTTGACAACATCTCCAGGGG + Intronic
1191667302 X:63716620-63716642 CATGGTGACCAGGTATCCAGAGG - Intronic
1194614877 X:96087949-96087971 CATGGTGACCAGATCCCCACAGG + Intergenic
1196409483 X:115400801-115400823 CATTGGGACGAGATGTCCACAGG + Intergenic
1201494421 Y:14577376-14577398 GAATGTGAGGAGATCTCCAATGG + Intronic