ID: 933634019

View in Genome Browser
Species Human (GRCh38)
Location 2:84687396-84687418
Sequence AATGCTGGTTCAACACATGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 189
Summary {0: 1, 1: 1, 2: 1, 3: 13, 4: 173}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933634014_933634019 17 Left 933634014 2:84687356-84687378 CCCAGGTTCCTGCACAGAGGTAC 0: 1
1: 0
2: 1
3: 12
4: 160
Right 933634019 2:84687396-84687418 AATGCTGGTTCAACACATGAAGG 0: 1
1: 1
2: 1
3: 13
4: 173
933634015_933634019 16 Left 933634015 2:84687357-84687379 CCAGGTTCCTGCACAGAGGTACG 0: 1
1: 0
2: 0
3: 2
4: 96
Right 933634019 2:84687396-84687418 AATGCTGGTTCAACACATGAAGG 0: 1
1: 1
2: 1
3: 13
4: 173
933634016_933634019 9 Left 933634016 2:84687364-84687386 CCTGCACAGAGGTACGTAGCAGG 0: 1
1: 0
2: 0
3: 3
4: 93
Right 933634019 2:84687396-84687418 AATGCTGGTTCAACACATGAAGG 0: 1
1: 1
2: 1
3: 13
4: 173

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933634019 Original CRISPR AATGCTGGTTCAACACATGA AGG Intronic
902325285 1:15696114-15696136 GATGCCTGTTTAACACATGAGGG + Intronic
904550350 1:31311637-31311659 AATGCTGTGTCCTCACATGACGG + Intronic
909050924 1:70767028-70767050 AAGGCTGGTTCAACACATGAAGG + Intergenic
910731885 1:90406581-90406603 AATTCTGGTTCAACAGATATGGG - Intergenic
914850247 1:151308802-151308824 AATGCTGTTTCTACAAAGGAGGG - Intronic
916226830 1:162497324-162497346 AATTCTGGTTCAGTCCATGACGG - Intronic
916638499 1:166700267-166700289 GTTGCAGGTCCAACACATGAGGG + Intergenic
919549816 1:198971032-198971054 AAGGATGGGTCAACAAATGAGGG + Intergenic
923017460 1:230137892-230137914 AATGCTGTTTAAAGACTTGAAGG - Intronic
924852368 1:247843272-247843294 AATTCTGGTTCAGATCATGATGG + Intergenic
924901962 1:248410742-248410764 AATGCTAGCTCAAAACATGGTGG - Intergenic
924909168 1:248490395-248490417 AATGCTTGTTAAATAAATGAAGG - Intergenic
924914937 1:248557663-248557685 AATGCTTGTTAAATAAATGAAGG + Intergenic
1063031214 10:2237381-2237403 ACTGCTGGTTCTGGACATGATGG + Intergenic
1067159228 10:43808916-43808938 AATATTGGTTAAACAAATGATGG - Intergenic
1067468178 10:46516926-46516948 AATGCTTGTTAAACAAAGGAAGG + Intergenic
1069212046 10:65773626-65773648 AATGCTGTTTTAACACATTTAGG + Intergenic
1070920765 10:80184288-80184310 AATGCATTTTCAACTCATGATGG - Intronic
1073470644 10:103720175-103720197 AATGCTGTGTCCTCACATGATGG + Intronic
1075281318 10:121140943-121140965 AATACTGGTTTACCAAATGATGG + Intergenic
1077763852 11:5135508-5135530 AAGGCTGGTTCAGGCCATGAAGG + Intergenic
1081150455 11:39622943-39622965 AATGCTGTATCCTCACATGATGG + Intergenic
1081154051 11:39667210-39667232 AATGCTAGTTCAGGCCATGATGG + Intergenic
1083145164 11:60752703-60752725 AATGCTGTGTCTTCACATGATGG + Intergenic
1084647869 11:70470673-70470695 AATGCTCATTCATCTCATGATGG + Intronic
1086953905 11:92916408-92916430 AATGCCTGTTCAACCCAGGAAGG - Intergenic
1090568906 11:128026092-128026114 ATTGTTGGATCAACACATGGGGG - Intergenic
1090584691 11:128198700-128198722 ATTGCTGGTGCCACAAATGATGG + Intergenic
1092791263 12:12072605-12072627 AATGCTGGTTCAGAACCTGGAGG - Intronic
1094644505 12:32308900-32308922 AAACCAGGTTCAACACAGGAAGG + Intronic
1095433240 12:42157188-42157210 CATGCTGCTTCAACTCATGGTGG + Exonic
1095864838 12:46960218-46960240 AATGGTTATTCAACAGATGAAGG - Intergenic
1095952398 12:47788871-47788893 ACTGATGGTTTTACACATGATGG - Intronic
1099505938 12:83476117-83476139 AATGCTGATTCAACACATAGAGG - Intergenic
1100179447 12:92069607-92069629 ATTCCTGGTTGAACAAATGAGGG - Intronic
1101013268 12:100473079-100473101 AATGATGGTTCAACTAATGAAGG + Intergenic
1104222082 12:126794883-126794905 AATGCTTATTGAACAGATGATGG - Intergenic
1104400046 12:128467869-128467891 CATCCTGGTGTAACACATGATGG - Intronic
1109614153 13:64808813-64808835 TTTGCTGGTTCAACACCTCATGG - Intergenic
1109975263 13:69823152-69823174 AATGCTGATTCAATAAATGATGG - Intronic
1110411416 13:75207674-75207696 ACAGATGGTTCAACTCATGAAGG - Intergenic
1111793368 13:92886717-92886739 AATGCTGATTCAACACTATAAGG + Intergenic
1111970584 13:94910664-94910686 AAGGCTGGTTCAACATATACTGG - Intergenic
1112209936 13:97366340-97366362 TCTGCTGGTTTAACCCATGATGG + Intronic
1112384402 13:98924773-98924795 TGTGCTGCTTCAAAACATGATGG - Intronic
1116289413 14:43013933-43013955 AATGGTGTTTCAACAAATAAAGG - Intergenic
1117186912 14:53249167-53249189 TATGCTCGTTTTACACATGAGGG - Intergenic
1117484973 14:56187036-56187058 ACTGCTCATTCAACAAATGAAGG + Intronic
1117644532 14:57837665-57837687 AGTGATGGTTCAAGAAATGATGG - Intronic
1121829917 14:97042448-97042470 ACTTCTGGTTCTACTCATGATGG - Intergenic
1122471745 14:101972503-101972525 AATGCTGCTTCAGCTCAGGAAGG - Intronic
1126174511 15:45723006-45723028 CATGCTGTTTCAACTCATGGTGG - Intergenic
1126412118 15:48383195-48383217 AATGCTGAGCCAACACATGGAGG - Intergenic
1128919181 15:71594693-71594715 AATGCTTGTTCGATACATGGAGG - Intronic
1130736530 15:86556279-86556301 AATGCTGCTCCAATACCTGAAGG - Exonic
1138172694 16:54867656-54867678 AATGCCAGCTCAAAACATGATGG + Intergenic
1146898907 17:36568260-36568282 GATGCTGGCTTAACACAAGAAGG - Intronic
1149526789 17:57362532-57362554 AATGCTGTTGCAACAGTTGACGG - Intronic
1150175857 17:63055047-63055069 AATCCAGGATCAAAACATGACGG - Intronic
1150505780 17:65697332-65697354 AATGCTGCTTAAACAAATGTGGG - Intronic
1156378189 18:36533096-36533118 ACTGGAGCTTCAACACATGAAGG + Intronic
1157084707 18:44567841-44567863 AATGCTTTTTCAACTTATGATGG + Intergenic
1160380460 18:78450942-78450964 CACGCTGGGCCAACACATGAAGG - Intergenic
1166654877 19:44603753-44603775 AAGACTGGTTCAGCCCATGACGG + Intergenic
1167524499 19:49975227-49975249 TGTGCTGGTTCAAGAGATGAGGG + Intergenic
926153975 2:10440465-10440487 AATGCTTGTTCAGCAGCTGAGGG + Exonic
928017515 2:27671745-27671767 AAAGCTGGTACAACACTAGAGGG + Intronic
928312273 2:30220820-30220842 AATGCAGGCTCAACAAATGTTGG - Intergenic
931207291 2:60160382-60160404 AATGCTGGCTCAACCCATTAAGG + Intergenic
931462080 2:62457884-62457906 AACGTTGGTGCAACAAATGAAGG - Intergenic
931609549 2:64083832-64083854 AATAGTTCTTCAACACATGAAGG + Intergenic
933634019 2:84687396-84687418 AATGCTGGTTCAACACATGAAGG + Intronic
937546585 2:123029432-123029454 GATGCTGTTTCAACATTTGATGG - Intergenic
939361239 2:141175511-141175533 AATGCAGGTTCAACACAACCTGG - Intronic
940781744 2:157940594-157940616 AATACTGGTTAAATACATGAAGG - Intronic
941595430 2:167471110-167471132 AATGCTGGATCAACAAAATAAGG + Intergenic
944974884 2:205038756-205038778 CATGTTTGTTCAACACATGATGG - Intronic
945153564 2:206813144-206813166 AATGCTGAGTGAACAAATGACGG + Intergenic
945580704 2:211591311-211591333 CATTCTAGTTTAACACATGAGGG + Intronic
946568561 2:220996022-220996044 AATTCTGCTTTAACAGATGATGG - Intergenic
946962548 2:225000249-225000271 ATTACTGGTTTTACACATGATGG + Intronic
947203969 2:227643577-227643599 CTTGCTGGTTTAACAAATGAAGG - Intergenic
947935427 2:233999607-233999629 AATGCTGGTTTATCAAAAGAAGG + Intronic
1169254221 20:4085102-4085124 AATACTGGTTAAATAAATGAAGG + Intergenic
1169963878 20:11193637-11193659 AATAATGGTTCAACATATAATGG - Intergenic
1170184919 20:13577972-13577994 AAGGCTTGTACAGCACATGAAGG - Intronic
1171023631 20:21609164-21609186 AATGCATGTTCACCACATCAAGG + Intergenic
1173748961 20:45461225-45461247 AATGCTGGTTAGACACCTGCAGG + Intergenic
1174033365 20:47649185-47649207 AATGTTTGTTAAACAAATGAAGG + Intronic
1174494460 20:50930403-50930425 AAGGCTGGTTCAAGGCATGGGGG + Intronic
1176264186 20:64200127-64200149 GATGCTGGTGCGCCACATGATGG - Intronic
1177176312 21:17704117-17704139 AAAGCTAGTTCAAGGCATGATGG + Intergenic
1177426770 21:20933703-20933725 AATGCTGTTTAAAGAGATGATGG - Intergenic
1178791451 21:35704177-35704199 AATGCTGTGTGAACACAAGAAGG - Intronic
1181833854 22:25585783-25585805 AATCCTGGGTCATCACATAAAGG + Intronic
1182599088 22:31445837-31445859 GATGCTGATCCAAAACATGAAGG + Intronic
949621911 3:5822450-5822472 AAAGCTAGCTCAACACCTGAGGG - Intergenic
950913411 3:16617968-16617990 AATGCTGGTTAGACTGATGAGGG - Intronic
955590040 3:60525315-60525337 AATTTTGGTTCAAAACAGGATGG - Intronic
955925566 3:64000825-64000847 AATGCTGTTTTAACATATTAAGG - Exonic
957656796 3:83089787-83089809 AAAGCTGGTGTATCACATGATGG + Intergenic
960846419 3:122008069-122008091 AATGCTTGTTGAATAAATGATGG + Intronic
969312150 4:6359977-6359999 AATACTGGTTCACCTCATGATGG + Intronic
970166759 4:13246631-13246653 GATGGTGGTACAACACATAAAGG - Intergenic
970343618 4:15131748-15131770 AATGCTGTGTCCTCACATGAGGG - Intergenic
970487201 4:16536554-16536576 AATGCCTGTTCATCACATGCTGG - Intronic
970921857 4:21403814-21403836 AATGCTGTGTCCACACATGGAGG + Intronic
973172263 4:47160451-47160473 ACTGCTCGTTTAACACATAAAGG - Intronic
977468225 4:97408748-97408770 AAAGCTGGTTCAGGCCATGATGG - Intronic
980414322 4:132464887-132464909 AATGCTTATTCAACATGTGAGGG + Intergenic
982140689 4:152314914-152314936 AATGCTGTTTCTACAGAAGATGG - Intergenic
983546484 4:168970006-168970028 AACACAGGTTCAACACATGCTGG + Intronic
983871422 4:172828543-172828565 TATGCTAATTTAACACATGATGG - Intronic
983917928 4:173312330-173312352 TATGCTGCTTCAGCTCATGATGG + Intronic
984401067 4:179264771-179264793 AAGGATGGTTCAACATATGCAGG + Intergenic
989320994 5:40133447-40133469 AATACTAGTTCAAGCCATGATGG - Intergenic
989506881 5:42236446-42236468 AATGCTGTGTCTTCACATGATGG + Intergenic
989644806 5:43619860-43619882 AAGGCTGCTTCAACTCATGGTGG + Intronic
991262661 5:64683965-64683987 TTTGCTGGTTCATCATATGATGG + Intergenic
993121135 5:83775413-83775435 AACGCTGTTTCCTCACATGATGG + Intergenic
993868331 5:93220964-93220986 AATGATGATCCAACACCTGAAGG + Intergenic
994201814 5:96985129-96985151 AATGCTGGTTCATCAAAACAAGG - Exonic
994223321 5:97222072-97222094 CATGCTGGTGCTACATATGAGGG - Intergenic
995882979 5:116863355-116863377 AATGCTGATTTACCAGATGAGGG - Intergenic
999006752 5:147989062-147989084 AAGGTTGGTTCAACATATGCAGG - Intergenic
999511642 5:152258440-152258462 AATGCAGGTTGAAAATATGAAGG + Intergenic
1001500444 5:172228419-172228441 AATGTTAATTCAAAACATGAGGG + Intronic
1003816432 6:9846315-9846337 AATGCTGGTTCAACATAAGAGGG + Intronic
1004404046 6:15315334-15315356 AATGCTGTTTGAACCCATGATGG + Intronic
1004890459 6:20096055-20096077 AATGTTAGTTGAACAAATGAGGG - Intergenic
1007844618 6:44742898-44742920 GCTGCTGGTTCTACTCATGAGGG + Intergenic
1009617476 6:66028917-66028939 AATGCTATATCAAAACATGATGG + Intergenic
1010584720 6:77643655-77643677 AATGCTAGTTCAGGCCATGATGG - Intergenic
1011571095 6:88736826-88736848 AATGCATGTTCACCACCTGATGG - Intronic
1012024827 6:93975447-93975469 AATGCTGGTTCTATAAATGTTGG - Intergenic
1013992263 6:116266894-116266916 AATGATGTTTCATCAAATGATGG + Intronic
1014942955 6:127465040-127465062 AATGCTTGTCCACCACAAGAGGG + Intronic
1016988873 6:149915976-149915998 AATGTTGGTTTAAGAGATGAAGG + Intergenic
1018111016 6:160536950-160536972 AATGCTGGTTTTACAGATAAGGG + Intronic
1018124706 6:160670468-160670490 AATGCTGGTTTTACAAATGAGGG + Intergenic
1018528581 6:164739674-164739696 ATTGCTGGTACAAAACATAAAGG - Intergenic
1019030526 6:169006501-169006523 AAGACTGGTTCAGCCCATGAAGG - Intergenic
1019703978 7:2488734-2488756 AATGTTGCTTGAATACATGAAGG - Intergenic
1020579996 7:9985105-9985127 AAAGCAGGTTCAGCACAAGATGG - Intergenic
1021246888 7:18274306-18274328 CATGCTGCTTCAACTCATGGTGG + Intronic
1021761734 7:23908942-23908964 AAAGCTGCTTCCACACATGTAGG - Intergenic
1021808253 7:24377952-24377974 AATGCTGGGTCACTACAAGATGG - Intergenic
1023915643 7:44586824-44586846 CATACTGGTTGAACAAATGAAGG - Intergenic
1024855902 7:53778991-53779013 GCTGCTGGTTCAATACATGTTGG - Intergenic
1028318485 7:89433886-89433908 AAGACTGGTTCAAGCCATGAAGG - Intergenic
1031062350 7:117066248-117066270 AACCCTGGTTCAACACTTGTGGG - Intronic
1032003200 7:128279862-128279884 AAGGCTGGTTCAACATATGCAGG - Intergenic
1032311016 7:130787186-130787208 CATGCTGCTTCCACTCATGATGG - Intergenic
1035134932 7:156693981-156694003 AAGTATGGTTCAACATATGAAGG + Intronic
1038116197 8:24558390-24558412 CTTGATGGTTCAGCACATGATGG + Intergenic
1041234073 8:55781261-55781283 AATGTTGGCCCAACACCTGAGGG + Intronic
1043652551 8:82614539-82614561 CATGCTGCTTCTACTCATGAGGG - Intergenic
1044620140 8:94182452-94182474 AAAGCTGGTTCAATCTATGAAGG + Intronic
1045109664 8:98928360-98928382 AATGCTGGTTGATCACAAAAAGG + Intronic
1045540258 8:103077579-103077601 AATGGTTGTTGAACAAATGAAGG - Intergenic
1046036721 8:108851745-108851767 AATGCTTGTTCAATAAATGAAGG + Intergenic
1048081009 8:131127066-131127088 GTTGCTGATTAAACACATGAGGG + Intergenic
1048420081 8:134269598-134269620 ATTGCTGGTTTCACAAATGAGGG - Intergenic
1048671810 8:136730771-136730793 AAGACTGGTTCAGGACATGAAGG + Intergenic
1050080569 9:1911663-1911685 AATGCTGGTTCTATAAATGCAGG - Intergenic
1050164282 9:2747909-2747931 AATGCTTGTTAAACACAGAAAGG + Intronic
1050736344 9:8767418-8767440 AATACTGGTTCAAAAAATGTGGG - Intronic
1052069075 9:24059072-24059094 CATGCTGGGTCAAAGCATGATGG + Intergenic
1052191197 9:25664622-25664644 AAGGCTGGTTCAAAACCGGAAGG - Intergenic
1052786919 9:32837012-32837034 AATGCTGCTTGAACATAAGAAGG - Intergenic
1053799601 9:41755901-41755923 AATACTGGTTCAGGCCATGATGG + Intergenic
1054903905 9:70397904-70397926 ATTGGTGGTTCTGCACATGAGGG - Intronic
1054952228 9:70865573-70865595 AATTATGGTTCAACACATGGGGG - Intronic
1055629103 9:78204759-78204781 AAGGCTGGTTCAACATATGTAGG + Intergenic
1058261058 9:102832379-102832401 ATTGCTGTGTCTACACATGATGG - Intergenic
1058271496 9:102977089-102977111 ATTGATGCTTCATCACATGATGG + Intergenic
1059438939 9:114291962-114291984 AATGCTGGGGCAACAAATGGAGG - Intronic
1185849569 X:3472992-3473014 AAGACTGGTTCAAGCCATGATGG - Intergenic
1186007510 X:5089617-5089639 AAAACTGGTTCAAGCCATGATGG + Intergenic
1190153592 X:47968843-47968865 AATCCTGCAACAACACATGATGG - Intronic
1192065576 X:67881219-67881241 AAGACTGGTTCAGGACATGATGG - Intergenic
1193392770 X:80948842-80948864 AGTGGTGGTTCAGCACATGGTGG + Intergenic
1194279819 X:91936065-91936087 AAGACTGGTTCAACCCATTATGG - Intronic
1194608327 X:96008887-96008909 AAGATTGGTTCAACACATGCAGG + Intergenic
1195627412 X:107018628-107018650 CAGGCTGCTTCAACTCATGAAGG + Intergenic
1196128476 X:112125783-112125805 AATGCTGTTTAAAATCATGAAGG + Intergenic
1196504543 X:116425742-116425764 AATGCAGATTGAACACATCATGG + Intergenic
1198681938 X:139192217-139192239 AATGCTGGTCCTAGACATCAGGG + Intronic
1200597296 Y:5159545-5159567 AAGACTGGTTCAACCCATTATGG - Intronic