ID: 933634254

View in Genome Browser
Species Human (GRCh38)
Location 2:84689938-84689960
Sequence TTCTTAGCTTTATCTTCTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 410
Summary {0: 1, 1: 0, 2: 3, 3: 38, 4: 368}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933634251_933634254 6 Left 933634251 2:84689909-84689931 CCAGATATTTGAAGATCATTCCC 0: 1
1: 0
2: 1
3: 4
4: 134
Right 933634254 2:84689938-84689960 TTCTTAGCTTTATCTTCTCCAGG 0: 1
1: 0
2: 3
3: 38
4: 368

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933634254 Original CRISPR TTCTTAGCTTTATCTTCTCC AGG Intronic
900254177 1:1688598-1688620 TTCTAAGCTTTATTTTTTTCTGG - Intronic
900262893 1:1741540-1741562 TTCTAAGCTTTATTTTTTTCTGG - Intronic
903115028 1:21172207-21172229 TACATAGCTTTCTCTTCTGCCGG - Intronic
904434127 1:30483232-30483254 CTCTTAGCTCTGTCTCCTCCTGG - Intergenic
905620905 1:39446004-39446026 ATCTTAGCTTTGCCTTCTGCAGG - Intronic
905815217 1:40944801-40944823 TTCTTACCTTTGTTTTTTCCTGG - Intergenic
906621400 1:47283883-47283905 TTCTTAGCTTTTTTTTTTGCGGG + Intronic
907264365 1:53247833-53247855 TTCTGAGTGTTTTCTTCTCCAGG + Intronic
907990294 1:59575386-59575408 TACTTAGCATAATGTTCTCCAGG + Intronic
909843478 1:80359871-80359893 TTCCTGGCCTTTTCTTCTCCAGG - Intergenic
910356694 1:86365554-86365576 TTCCTAGGTTTAACTTCTGCTGG + Intronic
910505708 1:87948165-87948187 ATGTCAGCTTTATCTTCTACAGG + Intergenic
910716656 1:90238298-90238320 TTTATAGCTTTATCTTTTCCTGG + Intergenic
911145182 1:94544891-94544913 TTCTCAGCTATCTCTCCTCCTGG - Intergenic
912098782 1:106180132-106180154 TTCTCATCTTTATCTTTTACTGG + Intergenic
912132147 1:106616745-106616767 ATCATTGCTTTATCTGCTCCAGG + Intergenic
912191892 1:107350705-107350727 TTCTTAGCATAATGTTCTCCAGG - Intronic
913067816 1:115272836-115272858 TTCTCTGCTTTATCTTTTCCAGG + Intergenic
914388914 1:147200319-147200341 TCCTGAAGTTTATCTTCTCCAGG + Intronic
914418020 1:147502552-147502574 TTCTTAACTTTATTTTCTATGGG + Intergenic
916314558 1:163435034-163435056 TTTTTAACTTTATCTTCTTGGGG + Intergenic
916396634 1:164396764-164396786 TTCTTTCCTTTATCTTTTCTTGG - Intergenic
919017457 1:192057555-192057577 AGCTTATCTTTCTCTTCTCCAGG + Intergenic
921302764 1:213766274-213766296 TTCTTAGTTTTGCCTTCTTCTGG - Intergenic
921585695 1:216943750-216943772 TTCTTCTGTTTATCTTTTCCTGG - Intronic
921672981 1:217946817-217946839 TTCTTAGCTTTTTCAACTCCCGG + Intergenic
922165233 1:223109852-223109874 TTCTTACCTTCGGCTTCTCCAGG - Exonic
922313708 1:224421872-224421894 TTATTAGCTTTATATTGTGCTGG + Intronic
922478410 1:225922495-225922517 TTCTTAGCTTTATGCCCTCAGGG + Intronic
922558640 1:226550975-226550997 ATCTTCCCTTTATTTTCTCCTGG - Intronic
924133480 1:240937509-240937531 TTCTTAACTTTATCTTCTCATGG - Intronic
1064699483 10:18004317-18004339 TTATTTACTTTTTCTTCTCCAGG - Intronic
1065474186 10:26116603-26116625 TTCTTATTTTTATATTTTCCTGG + Intronic
1065694055 10:28363527-28363549 CCCTTATCTTTATCTTCTCAGGG - Intergenic
1066754250 10:38694381-38694403 CTCTTATCTCTCTCTTCTCCTGG - Intergenic
1068375670 10:56176758-56176780 TTGTTTTCTTTAGCTTCTCCTGG + Intergenic
1069347441 10:67486824-67486846 TTCTTACCTTTCTCTTCTAAGGG + Intronic
1070067617 10:73053117-73053139 TTCTTTGCTCTATATTCTCCAGG - Intronic
1070379853 10:75871074-75871096 TTCTTATCTTTCTCTTTCCCAGG + Intronic
1070588615 10:77785561-77785583 TTCTTAGCATTTTCTTCTGCTGG - Intergenic
1071385285 10:85113369-85113391 TTCTTAACATTATACTCTCCAGG + Intergenic
1072170922 10:92860999-92861021 TTCTTCACTTTTTCTTTTCCTGG + Intronic
1075178628 10:120189275-120189297 TTCTTAGCTGTCTCTTTCCCTGG + Intergenic
1076580069 10:131501587-131501609 TGCTTTGCTTGATCTTCTCAAGG + Intergenic
1076905129 10:133357633-133357655 TTCGGCGCTTTTTCTTCTCCTGG - Intronic
1077732060 11:4741890-4741912 TTCTTAGCCTTCTCTTTTTCTGG - Intronic
1077764268 11:5141110-5141132 TTCTTAGCGTAATCTTTTCAAGG - Intergenic
1077771500 11:5223962-5223984 TTCTTAGTTTTACATCCTCCAGG + Intergenic
1079088557 11:17464641-17464663 TTCTGAGGTTTACCTTCCCCAGG - Intronic
1079526265 11:21392361-21392383 TTCTTGGCTTTCTCCACTCCAGG + Intronic
1080001065 11:27350821-27350843 TTCTATGCTTTATCTTCATCAGG - Intronic
1080006441 11:27412860-27412882 TTCTTAACTTTACGTTTTCCAGG - Exonic
1081638516 11:44737090-44737112 TTCTTAGCTATAGCTTCTTTGGG + Intronic
1083079460 11:60074965-60074987 TTCTTAGCTTTGTCTCCTGAGGG - Intergenic
1086113958 11:83227740-83227762 TTCATAGCTTTAGCATTTCCAGG + Exonic
1086227824 11:84533328-84533350 TTCTTAATCTTTTCTTCTCCAGG + Intronic
1086302146 11:85438373-85438395 TTCTTGTCTTTATTTTCTACAGG + Intronic
1086700210 11:89893088-89893110 TTCTTGGCTTTCTCTTTGCCTGG - Intergenic
1086705960 11:89951428-89951450 TTCTTGGCTTTCTCTTTGCCTGG + Intergenic
1087961510 11:104356048-104356070 TTCTTAGCTGTTTCTTTTCTTGG + Intergenic
1088615180 11:111619052-111619074 TTCTTAGAAGTATCTTCTTCAGG - Intronic
1088909171 11:114177730-114177752 TTCTAATCTCTTTCTTCTCCTGG - Intronic
1089446227 11:118554587-118554609 TTCTTACCTTTTTCTTAACCAGG - Exonic
1091007187 11:131964112-131964134 TTCTTAGATATCTCTTCTTCTGG - Intronic
1093561541 12:20547277-20547299 TTTATAGCTTTATCATCACCTGG + Intronic
1093805397 12:23426461-23426483 TTGTTACCTTTTTCTTCTACTGG + Intergenic
1093818360 12:23578653-23578675 TTCTAATCTTTATTTTCTCATGG - Intronic
1094311722 12:29091573-29091595 CACTTAGCTTAATGTTCTCCAGG - Intergenic
1094687380 12:32731335-32731357 TTCTAAGTTTTATTTTCTCAGGG + Exonic
1095299149 12:40561957-40561979 CTCATATCTTTATCTTTTCCAGG - Intronic
1096342482 12:50813328-50813350 TTCTTAGCTTCATTTTCTAGTGG - Intronic
1099095170 12:78366667-78366689 TCCTTAGGTTTATTTTCTCATGG + Intergenic
1099121869 12:78700595-78700617 TTCTTTTCTTTTTCTTCTCCTGG - Intergenic
1099539444 12:83888032-83888054 CTCTTAGCATAATGTTCTCCAGG + Intergenic
1099758562 12:86889238-86889260 CACTTAGGTTTATGTTCTCCAGG + Intergenic
1099921359 12:88961277-88961299 TTCTTAGATTTCTCTTCTTTTGG + Intergenic
1100158915 12:91834693-91834715 TTCTTAACTTTCTCTTGGCCAGG - Intergenic
1100925737 12:99546185-99546207 CTCTTAGATTTCACTTCTCCAGG - Intronic
1101012518 12:100465867-100465889 TTGTTAGGTTTGTTTTCTCCTGG + Intergenic
1102142597 12:110627626-110627648 TTTTTAACTTTATTTCCTCCTGG + Intronic
1103028570 12:117593796-117593818 TTCTTAGCTGTCTCTCTTCCTGG + Intronic
1103252979 12:119516724-119516746 TTCTAAGCTTTATTTGCCCCAGG - Intronic
1103368990 12:120403959-120403981 TTCTGTGCTTTAGTTTCTCCAGG - Intergenic
1103952883 12:124561196-124561218 TCCTTAGCTGTCACTTCTCCTGG - Intronic
1104080191 12:125423188-125423210 TAAATATCTTTATCTTCTCCTGG - Intronic
1104130217 12:125886306-125886328 TCCATAGTTTTGTCTTCTCCAGG + Intergenic
1104981408 12:132574549-132574571 GTCTCACCTTTATCTTCTGCTGG - Exonic
1106052314 13:26203272-26203294 ATCTTAGTTTTCCCTTCTCCAGG - Intronic
1106450316 13:29875540-29875562 TTTTTAGTTTTGTATTCTCCAGG + Intergenic
1107609415 13:42097852-42097874 TTGTTAGCTTCATCTTATCCTGG + Intronic
1107713272 13:43171760-43171782 TTCTTAGTTTCTTGTTCTCCAGG - Intergenic
1108201850 13:48052030-48052052 TTCTTAACTTTTTCTTTTTCTGG + Intergenic
1108254004 13:48593524-48593546 TTCTTCACTTTATATTCTTCTGG - Intergenic
1108997755 13:56756416-56756438 TTCTTATCTTTATCTTTGGCTGG - Intergenic
1109464265 13:62708139-62708161 TTCTTAGCATAATTTTCTCCAGG + Intergenic
1109715089 13:66211730-66211752 TTCTTGGTTATATCTTCTCACGG + Intergenic
1109831005 13:67788716-67788738 TCTTTAACTTTTTCTTCTCCTGG + Intergenic
1110271525 13:73596444-73596466 TTGTTAGCTTTATCTTAATCTGG - Intergenic
1110402512 13:75110155-75110177 GTCTTGGGTTTATCTTCTCATGG - Intergenic
1112349462 13:98620876-98620898 TTATTGGCTTTTTCTTCTCTTGG - Intergenic
1113221686 13:108111655-108111677 TATTTAGCTATATCTTCTGCAGG - Intergenic
1113599878 13:111561048-111561070 TTCCCAGCTCCATCTTCTCCTGG + Intergenic
1115519624 14:34220554-34220576 TTCTTAGCATTCTCTGTTCCTGG - Intronic
1116722410 14:48515615-48515637 TTCTTAGCATAATGTCCTCCAGG - Intergenic
1116964375 14:50999253-50999275 TTATTATCTTTTTTTTCTCCTGG - Intronic
1117835236 14:59798051-59798073 TTCTTAGCATCCTCTTATCCTGG + Intronic
1118478353 14:66140173-66140195 TTCCTAGCTTTGTCTCTTCCAGG - Intergenic
1120593292 14:86402236-86402258 TTGTTCGCTTGCTCTTCTCCAGG - Intergenic
1120782994 14:88502741-88502763 TTCCCAGCTTTACCTTCTGCTGG - Intronic
1125298124 15:38224269-38224291 TTCTTATCTTGATTTTCTCCTGG - Intergenic
1125779596 15:42252665-42252687 TTTTTATCTCTATGTTCTCCTGG + Intronic
1127085434 15:55420156-55420178 GATTTAGCTTTATCTTCTCCAGG - Intronic
1127290154 15:57562778-57562800 TTCTAAGTTCTTTCTTCTCCAGG + Intergenic
1128046188 15:64619306-64619328 TTCTGATTGTTATCTTCTCCTGG + Intronic
1130672948 15:85928971-85928993 TTCTTACCTTTTGATTCTCCAGG + Intergenic
1130724765 15:86427808-86427830 TTCCCAGCTGTGTCTTCTCCAGG + Intronic
1132917309 16:2357597-2357619 TTTTTATCTCTTTCTTCTCCTGG + Intergenic
1133077248 16:3289389-3289411 TTCTCAAATTTCTCTTCTCCTGG - Exonic
1133618391 16:7501795-7501817 TTCTTAAATTTATCTTCTCTGGG + Intronic
1135782957 16:25322332-25322354 CTCTTAGCATTCTCTTCTCCAGG - Intergenic
1135804357 16:25528731-25528753 TTCTAGGCATTATGTTCTCCGGG - Intergenic
1136368224 16:29819533-29819555 ATCTTACCTTCCTCTTCTCCAGG + Exonic
1136728486 16:32382746-32382768 CTCTTATCTCTCTCTTCTCCTGG + Intergenic
1138292647 16:55861183-55861205 TACTTTGCTGAATCTTCTCCAGG + Intronic
1141504624 16:84467471-84467493 TTCTAATCTGTATCTTTTCCTGG - Intergenic
1202997952 16_KI270728v1_random:135009-135031 CTCTTATCTCTCTCTTCTCCTGG - Intergenic
1142980833 17:3670331-3670353 TTCCTAGCTGTATCTCCTCTGGG - Exonic
1143581276 17:7828284-7828306 TTCTTACCTTATTCTTCTTCAGG + Intronic
1144280694 17:13723496-13723518 TTCTCAGTTTTTTTTTCTCCAGG - Intergenic
1144555616 17:16280185-16280207 TTCTAGGCCTTATCTGCTCCTGG + Intronic
1145302434 17:21650016-21650038 TTCTTAGTTTTATGTTCTGGGGG + Intergenic
1145347885 17:22053292-22053314 TTCTTAGTTTTATGTTCTGGGGG - Intergenic
1145415710 17:22712090-22712112 TTCTTAGTTTTATGTTCTGGGGG + Intergenic
1147399184 17:40169286-40169308 TTCCTAACTTTTTCTTCTCCTGG + Intronic
1148033696 17:44641684-44641706 TTCTGGCCTTTACCTTCTCCGGG - Intergenic
1148288980 17:46425000-46425022 TTCTTTGCTTTCTCTTCACTTGG - Intergenic
1148311149 17:46642577-46642599 TTCTTTGCTTTCTCTTCACTTGG - Intronic
1148387989 17:47249512-47249534 TTCTAAGATTTATGTTCTCTAGG - Intergenic
1149018115 17:51932240-51932262 TTGTTAGGCTCATCTTCTCCAGG - Intronic
1149164905 17:53739545-53739567 TTTTTAGCTTCATCTTTTCAAGG - Intergenic
1149975509 17:61261929-61261951 CTCTTAGCTTTCTCTTCACTAGG - Intronic
1150973470 17:70057372-70057394 TTCTTGTCTTTATCTTCTCCCGG - Intronic
1151372922 17:73660378-73660400 TTCTTAGCATTTGCTTCTCCTGG - Intergenic
1151504311 17:74516538-74516560 TTCTCAGCTCCATCTCCTCCAGG - Intergenic
1154077396 18:11217402-11217424 TTCTTATATTTATCTGCTCCTGG - Intergenic
1155273114 18:24159939-24159961 TTTTTAGCTACATCTTCTACTGG - Exonic
1155575241 18:27238589-27238611 TTCCTGGCCTTATCTTCTCGAGG + Intergenic
1155717737 18:28968372-28968394 TGCTTAGCATGATATTCTCCAGG - Intergenic
1156867034 18:41900317-41900339 TTCCAAGTTTTATCTTCTACAGG + Intergenic
1157585032 18:48795537-48795559 TTCTTAGTTTTATCTTATTCGGG + Intronic
1157635779 18:49152832-49152854 TACTTAGCATAATGTTCTCCAGG - Intronic
1157804397 18:50647448-50647470 TTCATTTCTTTTTCTTCTCCAGG - Intronic
1159749826 18:72286468-72286490 TCCTTAGTTTTATCTTCATCTGG - Intergenic
1159898372 18:74019063-74019085 TCCTCATCTTTATTTTCTCCTGG - Intergenic
1160038867 18:75325588-75325610 TTGTTAGGTTGCTCTTCTCCTGG - Intergenic
1160414376 18:78697891-78697913 TATTTAGCTTTCTCTTCTCTGGG + Intergenic
1160900060 19:1423413-1423435 TCTTTAGATTTCTCTTCTCCAGG + Intronic
1161558858 19:4959571-4959593 CTCTCAGCTCTGTCTTCTCCTGG + Intronic
1162243083 19:9373258-9373280 TACTTAGCATGATGTTCTCCAGG + Intronic
1164818146 19:31222636-31222658 TTCTTTTCTGTATCTTCTACGGG + Intergenic
1164942035 19:32258071-32258093 TTCTTTGTTTTTTCTTTTCCTGG + Intergenic
1165450872 19:35881751-35881773 TTCTTAGCTCTGACTTTTCCTGG - Intergenic
1166024233 19:40066006-40066028 TCCTTAGCTGTGTCTTCCCCTGG + Intergenic
1167304653 19:48700640-48700662 TTCTTAGCTGTATCATCTCACGG + Intronic
1167305260 19:48704594-48704616 TTCTTAGCTGTATCATCCCATGG + Exonic
1167411768 19:49348288-49348310 TTCTGTGCTTGAGCTTCTCCTGG - Intronic
925383170 2:3442605-3442627 TTGTTACCTTTCTTTTCTCCAGG + Intronic
925452943 2:3986326-3986348 TTCTGACCCTTGTCTTCTCCAGG + Intergenic
925847852 2:8049903-8049925 TTCTCAGCTTTAACTCCTCTTGG - Intergenic
926931101 2:18041851-18041873 TTATCAGCTTTTTCTTCTTCAGG + Intronic
928598747 2:32883211-32883233 TTCTTAGCTTTATTTCCTTAAGG - Intergenic
929223936 2:39493879-39493901 TACTTAGCTTAATGTTCTTCAGG + Intergenic
930209758 2:48623200-48623222 TTCTTAATTATATCTTCTCATGG + Intronic
930876181 2:56219840-56219862 GTCTAAGTTTTATCTGCTCCAGG - Intronic
931075606 2:58708059-58708081 TTCTTCTCTTTAATTTCTCCTGG + Intergenic
931085793 2:58829558-58829580 TTCTTAGATTTGTCTTCTTGAGG + Intergenic
931376518 2:61713114-61713136 TTCTGAGCCTTGTCTTTTCCAGG + Intergenic
931869600 2:66444418-66444440 TTCTCAGCTTGATTTTCTCTGGG + Intronic
931974608 2:67629588-67629610 CTCTTATCTTTCTCTTTTCCTGG - Intergenic
932365298 2:71148091-71148113 TTCTTACCTTGATCTCCTCTGGG - Exonic
933634254 2:84689938-84689960 TTCTTAGCTTTATCTTCTCCAGG + Intronic
933761622 2:85676139-85676161 TTCTTTGCTTTCTCCTTTCCTGG - Intergenic
934317543 2:91938640-91938662 CTCTTATCTCTCTCTTCTCCTGG - Intergenic
935371241 2:102349237-102349259 TCAATAGCTTTACCTTCTCCAGG - Exonic
935646076 2:105336147-105336169 TTCTCAGCTTTATCTTTTTGAGG + Intergenic
935673512 2:105575275-105575297 TTCTAAGCATTACCTTCTCTGGG - Intergenic
935862629 2:107349597-107349619 ATCTAAGCTTTGTCTTCTCTGGG + Intergenic
937363057 2:121242415-121242437 TTCTTTTCTCCATCTTCTCCCGG + Exonic
937522889 2:122733515-122733537 TTCTTAGCTTTAATTAATCCAGG + Intergenic
937759964 2:125589371-125589393 TTCTTAGCTCTATGTTCACAGGG - Intergenic
939379866 2:141421034-141421056 TTCTTGGCTTTGTGCTCTCCTGG + Intronic
939809670 2:146815168-146815190 TTCTTAGCTATTCCTCCTCCAGG - Intergenic
941136522 2:161724121-161724143 TTCTTTTCTTTCTCTTCACCTGG + Intronic
941790182 2:169543792-169543814 TTCTTAACTTTTTGTTATCCAGG - Intronic
941850683 2:170177127-170177149 TACCTAGATTTATCTGCTCCAGG + Intergenic
944127828 2:196314242-196314264 TGCTCAGCTTTCTCTTCTTCTGG - Intronic
945358515 2:208867344-208867366 TTGTTTCCTTTATCTTTTCCAGG - Intergenic
946584184 2:221165665-221165687 TTCTTAAATTCATCTGCTCCAGG + Intergenic
947864865 2:233389672-233389694 TTATTAGTTTGATTTTCTCCAGG + Intronic
947975658 2:234363706-234363728 TTCTCAGCTGTATCTTCTCGGGG - Intergenic
1169483096 20:6002793-6002815 TTCTTTACATTATCTTCTTCTGG + Intergenic
1171519018 20:25761443-25761465 TTCTTAGCTTTCTGTTCTGGGGG + Intergenic
1172150836 20:32789246-32789268 TTCTTAGATTTATCTTTTGGGGG + Intronic
1175003774 20:55660117-55660139 ATATTGGCTTTATCATCTCCTGG - Intergenic
1176653166 21:9567846-9567868 TTCTTAGTTTTATGTTCTGGGGG + Intergenic
1177302122 21:19261383-19261405 TTCAAAGCCTTATTTTCTCCTGG - Intergenic
1177440546 21:21117606-21117628 TACTTAGCATGATTTTCTCCAGG - Intronic
1179091510 21:38270166-38270188 TTCTAAATGTTATCTTCTCCAGG + Intronic
1179130611 21:38633089-38633111 TTCTTAGCTTAATGTCCTCAAGG - Intronic
1180305709 22:11122315-11122337 CTCTTATCTCTCTCTTCTCCTGG - Intergenic
1180544228 22:16484498-16484520 CTCTTATCTCTCTCTTCTCCTGG - Intergenic
1181494240 22:23279017-23279039 CTCTTAGCTGTTTCTTCTCCAGG + Intronic
1181507304 22:23368549-23368571 TACTTTGCTGAATCTTCTCCAGG + Intergenic
1184077394 22:42190622-42190644 TTGTTAGCTTTAACTCCTCCTGG - Intronic
1185091477 22:48778089-48778111 TTCCCAGCTTTTTATTCTCCTGG + Intronic
1185159873 22:49217163-49217185 CTCTTAGCTGTCTCTTTTCCTGG - Intergenic
951402935 3:22257035-22257057 TTCTTCTTTTTATCTTCTCCAGG - Intronic
951468257 3:23026201-23026223 TTCTTTTCATAATCTTCTCCTGG + Intergenic
952644786 3:35641938-35641960 GTTTTAGATTTATCCTCTCCAGG + Intronic
953035177 3:39204901-39204923 TCCAAGGCTTTATCTTCTCCAGG + Intergenic
953467231 3:43133166-43133188 TCCTTGGCTCTATCTTCCCCTGG + Intergenic
955581244 3:60425321-60425343 GTCTTGGCTTTATCTCCTTCTGG - Intronic
957715184 3:83919332-83919354 TTCTGGGCTTTGTATTCTCCTGG + Intergenic
957897280 3:86439032-86439054 CTCTTAGCTTTCTCTTTTCATGG + Intergenic
958024879 3:88038913-88038935 TCCTCAGCCTTATCTTCTGCTGG - Intergenic
958810414 3:98854485-98854507 TTCCTATCATTATCTTCTGCAGG - Intronic
960651023 3:119950352-119950374 TTCTTACCTTTATATCATCCAGG - Intronic
963012306 3:140782104-140782126 TCTTTAGATTTATCTTCTCTGGG - Intergenic
963692428 3:148520786-148520808 CTCTTAGCTTTTTCCTTTCCAGG - Intergenic
964509985 3:157439360-157439382 TGCTTTGATTTATCTTCTCTTGG + Intronic
964635247 3:158851201-158851223 TTCTTGGCTCCATTTTCTCCAGG + Intergenic
964749938 3:160045146-160045168 TTTTTTACTCTATCTTCTCCAGG + Intergenic
965160546 3:165128548-165128570 ATCTAAGCTGTATCTTCTCTAGG + Intergenic
965178345 3:165365575-165365597 TCTTTAGCTTTATATTCTCCAGG + Intergenic
966161999 3:176978504-176978526 TTTTTACCTTTATCTTCTGTTGG + Intergenic
967675569 3:192294871-192294893 TTCTTAGTTTTATATACTCAAGG - Intronic
969127441 4:4962650-4962672 TTCTTAGTCTTATTTTCTTCAGG + Intergenic
969192916 4:5536861-5536883 TTCTTAGCTTATTTTTCTCCAGG - Intergenic
970488357 4:16546791-16546813 TTTCTAGCTCTCTCTTCTCCTGG + Intronic
970563183 4:17303475-17303497 TTCAGAGCCTTATCTTATCCAGG + Intergenic
970675665 4:18447608-18447630 TTCTTTTCTTTATCTTTGCCTGG - Intergenic
970805822 4:20030883-20030905 TTTATAGCTTTATCTTCTTGAGG - Intergenic
970814089 4:20133016-20133038 TTCTTCCATTTATTTTCTCCTGG - Intergenic
971930862 4:33081039-33081061 TGCTTGGCTGTATCCTCTCCTGG + Intergenic
972885030 4:43475538-43475560 TTCTTAGCTATATCTGCTTTAGG + Intergenic
972953570 4:44360261-44360283 TTATTTGCTTTATATACTCCTGG + Intronic
973176155 4:47208198-47208220 TTCTTAGCATTATGTTTTCAAGG - Intronic
973294230 4:48497922-48497944 TGCTTAGCTTTACCTTTTCTTGG - Exonic
973668592 4:53190148-53190170 TCCTTAGCCTTATCTTCAACAGG + Intronic
974903437 4:68030184-68030206 TTTTTAAAGTTATCTTCTCCTGG - Intergenic
975035214 4:69670751-69670773 ATCTCAGCTGTATCTTCTTCAGG - Intergenic
975084748 4:70324634-70324656 GACTTAACATTATCTTCTCCAGG - Intergenic
975924440 4:79432117-79432139 TCCTTGGCTTTATCTTCTTCAGG + Intergenic
976400505 4:84601574-84601596 TTCGTAGCTGCTTCTTCTCCAGG - Intronic
976711073 4:88072306-88072328 TTCTTAGCTGTCTCTTTCCCTGG + Intronic
977055558 4:92186227-92186249 CTCATAGATTTATCTTTTCCAGG + Intergenic
977395114 4:96461423-96461445 CTGTTAACTTTATCTTCTACGGG + Intergenic
977743743 4:100519299-100519321 TTCCTATCTTTATATTCTCCAGG - Intronic
977949781 4:102957222-102957244 CTCTTATCTCTCTCTTCTCCTGG - Intronic
978591359 4:110328175-110328197 TTCTTAGCTTTATGTTCATCAGG + Intergenic
979479465 4:121199681-121199703 TGATCAGCTTTCTCTTCTCCAGG - Intronic
981285786 4:143017841-143017863 TTCTTAGTTTTTGCTTCTCTGGG + Intergenic
982302369 4:153892800-153892822 GTATTAGCTTTTTCTTCCCCAGG + Intergenic
982520252 4:156407492-156407514 TTCATATCTTTCTCTTGTCCAGG - Intergenic
983636330 4:169901150-169901172 TTCTGAGCCTTATTTTCTCTAGG - Intergenic
984084752 4:175294991-175295013 TTCTCAGCCTTATCTTCTCTAGG + Intergenic
984529978 4:180903973-180903995 TACTTAACATTATGTTCTCCAGG + Intergenic
984623241 4:181976796-181976818 TTTGTAGCTCCATCTTCTCCAGG - Intergenic
984633882 4:182090477-182090499 TCCTTAGCTTTATTCACTCCTGG - Intergenic
985871322 5:2559645-2559667 CTTTTAACTTTATATTCTCCAGG + Intergenic
986324611 5:6662715-6662737 TTCTTGAATTTATGTTCTCCAGG + Intronic
987241747 5:16007003-16007025 TTCTTACCTCTATCTTCTATTGG - Intergenic
987758234 5:22124703-22124725 TTCTTAAATTTATCTTTCCCTGG + Intronic
987911797 5:24155829-24155851 ATCTCAGCTTTATCTACTTCAGG - Intronic
988384540 5:30544169-30544191 TACTTAGCTTTAGCTATTCCAGG - Intergenic
988424824 5:31051875-31051897 TTCTTAACTTTATCTTGCCAGGG + Intergenic
989359824 5:40588875-40588897 TTCCTAGCTTTCTCTTCCCTGGG - Intergenic
989668480 5:43886025-43886047 TACTTTGCATTATCTCCTCCTGG - Intergenic
990842506 5:60099002-60099024 CTCTTAGCTTTCTTTTCTCTGGG + Intronic
990907647 5:60820860-60820882 TCCTGAGCTTTATCATCTCTTGG + Intronic
990994526 5:61718156-61718178 TTTTTAGTTTTATTTTTTCCTGG + Intronic
991029790 5:62070981-62071003 TTCTTGGCGTTTTCTTCCCCAGG - Intergenic
991129864 5:63110200-63110222 TTCTTAGCTTCATCTTCTGCTGG + Intergenic
991270216 5:64770247-64770269 TTCTTTGTTTGAACTTCTCCTGG + Intronic
992563739 5:77977264-77977286 CTCTTGGATTTATCTTCTTCTGG - Intergenic
993388636 5:87290694-87290716 TCCATAGTTTTACCTTCTCCAGG + Intronic
994432092 5:99679364-99679386 ATTCTAGCTTTTTCTTCTCCAGG - Intergenic
994577704 5:101600989-101601011 TGCTTAGCATAATTTTCTCCAGG - Intergenic
994615696 5:102101303-102101325 CTCTTAGCTTTCTCTTTTTCTGG + Intergenic
995351874 5:111186313-111186335 TTTTTAGCTTGATCTTTTTCAGG - Intergenic
995555135 5:113319933-113319955 TTCTTAGCATAATTTTATCCTGG + Intronic
995708196 5:115007194-115007216 TTCTAAGTTTGATCTTTTCCTGG - Intergenic
996106574 5:119511373-119511395 TTCTTAGCTATCTCTTTCCCTGG - Intronic
997069184 5:130599334-130599356 TTCTTTGCTTTATCTTCACATGG + Intergenic
997697099 5:135870279-135870301 TTCTTGACTTTCCCTTCTCCAGG - Intronic
998162874 5:139823260-139823282 TTCTTTCCTCTATCTGCTCCGGG + Intronic
999507790 5:152216225-152216247 TACTTAACATTATGTTCTCCAGG + Intergenic
1000436864 5:161221971-161221993 TTCTTATCTTTCTCCTCTCCTGG - Intergenic
1000664243 5:163974857-163974879 TTCTTAGCATTATGTCTTCCAGG + Intergenic
1001429554 5:171648469-171648491 TGCTTAGCCCTCTCTTCTCCTGG - Intergenic
1002900044 6:1402598-1402620 TCCTTGGCTTTGTCCTCTCCCGG - Intergenic
1003373978 6:5557222-5557244 TTCTTAGCTGGGTCTTCTCTTGG - Intronic
1004033225 6:11894170-11894192 TTCTTAGCTGTTTCTTTCCCTGG + Intergenic
1004294301 6:14396061-14396083 TTTTTTGCCTTCTCTTCTCCAGG + Intergenic
1004577915 6:16916208-16916230 CTCTCATCTTTTTCTTCTCCAGG + Intergenic
1005112524 6:22298878-22298900 TTCTTAGATTGCTCTTATCCTGG - Intergenic
1005140193 6:22622978-22623000 TTCTCTGCTTTATCTTGTCAAGG + Intergenic
1005831798 6:29677024-29677046 TTTCTAGCTTTATCCACTCCTGG + Exonic
1006112399 6:31755865-31755887 TTTTTCTCTTTTTCTTCTCCTGG + Intronic
1007725107 6:43911402-43911424 TTCTTAGCTTCGTCATCTGCTGG + Intergenic
1008167621 6:48158814-48158836 TTCCTAGCTTTGTCTTTCCCTGG + Intergenic
1008745132 6:54660406-54660428 TTCTTAGTTTTATGTCCTCTTGG - Intergenic
1008960486 6:57261179-57261201 TTCTTACCTTTGTCATCTCCTGG - Intergenic
1009611190 6:65943572-65943594 TTCTTTGGCTTCTCTTCTCCAGG + Intergenic
1010579666 6:77579469-77579491 TTCTAAGCTTTATCTTCTTAAGG + Intergenic
1010902627 6:81446255-81446277 TTCTGAGTTTGTTCTTCTCCTGG - Intergenic
1011870199 6:91883463-91883485 ATCTCAGCTTTATCTTTACCTGG + Intergenic
1011917302 6:92523615-92523637 TTCTTAGCTGTCTCTTTCCCTGG + Intergenic
1012244402 6:96910269-96910291 TTTTTTGCTTTATCTTCTGTTGG - Intergenic
1014054286 6:116995721-116995743 TCCTTACCTTTATCTTCACAAGG - Intergenic
1014104968 6:117551277-117551299 TTGTTTTCTTTATTTTCTCCTGG + Intronic
1014325252 6:119985902-119985924 TTCTTAGTTATCTCTTTTCCTGG + Intergenic
1015960046 6:138639178-138639200 TTCTTTTCTCTATCTACTCCTGG + Intronic
1016200449 6:141400910-141400932 ATCTTAGCTTTATCATTTTCTGG + Intergenic
1018376062 6:163214032-163214054 TTCTTAACTATTTCTTCTCCAGG + Intronic
1020623495 7:10547494-10547516 TTATTACCTTTCTCTTCTGCTGG - Intergenic
1021305147 7:19022918-19022940 TTCTTATCCTTATCATATCCTGG - Intronic
1021709630 7:23402316-23402338 TTCTTAGCTTTATATACTTACGG - Intronic
1021743037 7:23706870-23706892 TTTTTAACTTTATATTTTCCTGG - Intergenic
1021946126 7:25729323-25729345 TTTATACATTTATCTTCTCCAGG - Intergenic
1022018291 7:26373886-26373908 TTCTTAGCTTTTTTTTCTGTTGG - Exonic
1024449107 7:49518277-49518299 TTCTTAACTTTCTCTTCTGATGG + Intergenic
1024661052 7:51495655-51495677 TCCTTAGTTTTTGCTTCTCCGGG + Intergenic
1025279512 7:57616576-57616598 TTCTTAGTTTTATGTTCTGGGGG + Intergenic
1025305219 7:57848924-57848946 TTCTTAGTTTTATGTTCTGGGGG - Intergenic
1025935011 7:66028658-66028680 TTCTTTTGTGTATCTTCTCCTGG - Intergenic
1026397315 7:69968538-69968560 CTCTGAGCTATATCCTCTCCTGG - Intronic
1026534712 7:71230094-71230116 CCCTTTGCTTTCTCTTCTCCAGG - Intronic
1028880822 7:95877698-95877720 TTCTTAGCTGTCTGTTTTCCTGG - Intronic
1031090688 7:117350010-117350032 TTCTTAGCTGTCTCTTTCCCTGG - Intergenic
1031573357 7:123386113-123386135 TTCTTGGCTCTATCCTCCCCTGG + Intergenic
1031585548 7:123528652-123528674 GTCTTAGCTTTTTCATCTGCAGG - Intronic
1032360928 7:131253896-131253918 TTCTTAGCTGTCTCTTTCCCTGG - Intronic
1033771862 7:144561157-144561179 TGCTTATCTTTGTTTTCTCCTGG + Intronic
1033883796 7:145919768-145919790 TTTTTATCTTTCTCTTCTCCTGG + Intergenic
1035378112 7:158420403-158420425 ATCTTGGCTTTGTCTTTTCCTGG + Intronic
1035866321 8:3086521-3086543 TTCATAGTTTTATCTTATCAAGG - Intronic
1035950625 8:4016630-4016652 CTCTTTGCTTTGTCTTCTACAGG + Intronic
1037410512 8:18591124-18591146 TTCTTGGCTTTGTGCTCTCCTGG - Intronic
1039298464 8:36183324-36183346 TACTTAGCATAATCTCCTCCAGG + Intergenic
1039712462 8:40069838-40069860 TGCTTAGCATAATGTTCTCCAGG - Intergenic
1040026080 8:42784132-42784154 TTCTTAGCTATCTCTTTTTCTGG + Intronic
1041432905 8:57804474-57804496 TGCTTTCCTTTATTTTCTCCTGG - Intergenic
1041667889 8:60463613-60463635 TCCTCAGCCTTCTCTTCTCCAGG - Intergenic
1043745989 8:83874185-83874207 TTATTAGCTTGTTTTTCTCCTGG - Intergenic
1044880388 8:96717619-96717641 TTCTTTGCTTTATGTTACCCAGG + Intronic
1046190591 8:110789903-110789925 TTCTTAGCTTTATCATTTTTAGG + Intergenic
1046558148 8:115802415-115802437 TCCTTTGCTTTATCTTCCCTGGG + Intronic
1046689074 8:117262541-117262563 TACTTAGCTTTATATTTTCAAGG + Intergenic
1047171241 8:122495103-122495125 TTCTTAGTTTTTGCCTCTCCAGG - Intergenic
1047598746 8:126405603-126405625 TTCTTAGCTTTGTATCCTCAGGG - Intergenic
1047672072 8:127158937-127158959 TTCTTAGCATTTTTTTGTCCTGG + Intergenic
1049184707 8:141243856-141243878 TTCTTAGCTATGTTTTCTTCAGG + Intronic
1049285605 8:141773528-141773550 TTCATACCTTTAATTTCTCCAGG + Intergenic
1050274130 9:3979142-3979164 TTCTTAGAAGCATCTTCTCCTGG + Intronic
1050283505 9:4077438-4077460 TTCTAAGTTTTATTTTCTCCAGG - Intronic
1051478159 9:17531429-17531451 TTCTTAGCATTTTCTGCTCTGGG - Intergenic
1051709330 9:19914161-19914183 TCCTTACTTTTATCTTGTCCAGG + Intergenic
1051740670 9:20248804-20248826 TTGTTAGCATTTACTTCTCCGGG + Intergenic
1051875857 9:21792662-21792684 TACTTAGCATAATTTTCTCCCGG - Intergenic
1052275980 9:26677210-26677232 TTCCTATCTTTATCTTTGCCTGG - Intergenic
1052528678 9:29654940-29654962 TTCTTAGCTTAATGTCCTGCAGG - Intergenic
1052927092 9:34027159-34027181 ATCTGAGCTTTGTCTTCTGCAGG - Intronic
1055041483 9:71878393-71878415 GTCTTATCTTTATTTTCTCCTGG - Intronic
1055255588 9:74366579-74366601 TTTGGATCTTTATCTTCTCCTGG + Intergenic
1055844962 9:80550711-80550733 TGCTTAACTTTCTTTTCTCCTGG - Intergenic
1056238698 9:84621871-84621893 TTCTTAACTTTCTCCTCTTCAGG - Intergenic
1056760651 9:89412208-89412230 TCCTTACCTTTGTCCTCTCCGGG - Intronic
1057433454 9:95017060-95017082 TTCATAGCTTTTTCTCCTCTTGG - Intronic
1058226387 9:102369716-102369738 CACTTAGCATTATGTTCTCCAGG - Intergenic
1058261160 9:102834198-102834220 TTCATAGCTTTAACTTCTTTGGG - Intergenic
1058548109 9:106082609-106082631 TTGTTAAACTTATCTTCTCCCGG - Intergenic
1059034584 9:110740179-110740201 TTCATGACTTTCTCTTCTCCAGG + Intronic
1061602266 9:131679029-131679051 CTCTTAGCCTTTGCTTCTCCGGG - Intronic
1062088549 9:134661702-134661724 TTCTTAGCTGTAATCTCTCCAGG + Intronic
1203630897 Un_KI270750v1:71386-71408 TTCTTAGTTTTATGTTCTGGGGG + Intergenic
1187359122 X:18608245-18608267 TTCTTGTCTTAATCTTCTCTAGG - Intronic
1187987885 X:24834277-24834299 TTTTGAGAATTATCTTCTCCAGG + Intronic
1188055692 X:25538588-25538610 TTCTTAGCTTGGTCTTCTATAGG + Intergenic
1188941997 X:36251134-36251156 TTCTTAGATTTCTCTTCTACTGG + Intronic
1189026827 X:37403945-37403967 TCCTTGGTTTTATCTTCCCCTGG + Intronic
1189352777 X:40289204-40289226 CATTTACCTTTATCTTCTCCAGG + Intergenic
1189864601 X:45312641-45312663 TTCTTTGCTTTTTCCTTTCCAGG + Intergenic
1192890028 X:75380592-75380614 ACCTTAGCTTAATCTTATCCTGG - Intronic
1193305003 X:79938682-79938704 CACTTAGCATTATGTTCTCCAGG + Intergenic
1194494157 X:94589243-94589265 TTCTTATCTTTACATTCACCAGG - Intergenic
1194942930 X:100033986-100034008 TTCTTAGCCTACTCTTCTCTGGG - Intergenic
1196136406 X:112214291-112214313 TTCTTAGCACAATGTTCTCCAGG + Intergenic
1197606929 X:128596153-128596175 GTCTTGGGTTTATCTTCTCGCGG + Intergenic
1198440153 X:136655248-136655270 GACTGAGCTTTTTCTTCTCCAGG + Intronic
1199080110 X:143567684-143567706 TTCCCAGTTTTATCTTCCCCAGG + Intergenic
1199251627 X:145669309-145669331 TACTTAGCATAATGTTCTCCAGG + Intergenic
1199577900 X:149332373-149332395 TTCTTAGCTTTCTATTTTCTGGG - Intergenic
1199782175 X:151072063-151072085 TGCTTCTCTTTATCTTCTTCGGG - Intergenic
1199841963 X:151658322-151658344 TTCTTGGCTTTGTTTTTTCCAGG + Intronic
1199882182 X:151982610-151982632 TGCTTGGCTTCATCTTCACCAGG - Intergenic
1200395613 X:155985351-155985373 TACTTAGCTCTATCTCTTCCTGG + Intergenic
1200754268 Y:6975380-6975402 GTCTTAGCATGATCTTCTCTTGG + Intronic
1201184848 Y:11391058-11391080 CTCTTATCTCTCTCTTCTCCTGG - Intergenic
1201984939 Y:19955652-19955674 TACTTAGCTTAATTTTCTCCAGG + Intergenic