ID: 933634842

View in Genome Browser
Species Human (GRCh38)
Location 2:84697680-84697702
Sequence AGACCAAGAGCAAAAGAAGT AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 554
Summary {0: 1, 1: 0, 2: 3, 3: 30, 4: 520}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933634836_933634842 25 Left 933634836 2:84697632-84697654 CCTAATTTATTTGAAAAGGATGA 0: 1
1: 1
2: 1
3: 38
4: 433
Right 933634842 2:84697680-84697702 AGACCAAGAGCAAAAGAAGTAGG 0: 1
1: 0
2: 3
3: 30
4: 520

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933634842 Original CRISPR AGACCAAGAGCAAAAGAAGT AGG Exonic