ID: 933638648

View in Genome Browser
Species Human (GRCh38)
Location 2:84735092-84735114
Sequence TTGGGTACACACAGACATAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 387
Summary {0: 2, 1: 2, 2: 16, 3: 60, 4: 307}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933638648_933638653 18 Left 933638648 2:84735092-84735114 CCTTTATGTCTGTGTGTACCCAA 0: 2
1: 2
2: 16
3: 60
4: 307
Right 933638653 2:84735133-84735155 AAGTGAGACCATACAGTATTTGG 0: 1
1: 146
2: 1815
3: 4156
4: 11772

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933638648 Original CRISPR TTGGGTACACACAGACATAA AGG (reversed) Intronic
901166721 1:7226621-7226643 TTATGTACACATAGACATATAGG + Intronic
901200452 1:7464187-7464209 TTGTGTATACACAAAAATAAGGG + Intronic
901452853 1:9346422-9346444 CTGGGGACAGACAGACAGAAAGG - Intronic
902534727 1:17112928-17112950 TGGGGCACACAGAGACAGAAAGG - Intronic
903308500 1:22432367-22432389 TTGGGTACACTCAGCCTTAGAGG + Intergenic
904986419 1:34552866-34552888 TTGGGTAAATAAAGAAATAAAGG + Intergenic
905318680 1:37099983-37100005 TTTGGAACACACAGACATCTGGG + Intergenic
905698729 1:39995791-39995813 TTTTCTACACAAAGACATAAAGG - Intergenic
905974779 1:42166206-42166228 TTGGCTACACACACCCATCAGGG - Intergenic
907198617 1:52707120-52707142 CTGGGTCCACACACACATTATGG - Intergenic
907254614 1:53169310-53169332 ATGGGTACACATGGACATACAGG + Intergenic
907401324 1:54226611-54226633 TTGGGCACAGACAGACAGCAGGG + Exonic
907910016 1:58817099-58817121 ATGGGTACACATGGACATAAAGG + Intergenic
909399609 1:75212385-75212407 TTGAGTACACATAGACACAAAGG - Intronic
909819967 1:80049838-80049860 TTGGGTACAGAAAAACAAAAGGG + Intergenic
910488693 1:87744563-87744585 TTGGGTAATCACACACATCAAGG + Intergenic
910610887 1:89140996-89141018 TTGAGTACACATGGACACAAAGG + Intronic
910710896 1:90179207-90179229 TTGAGTACACATGGACACAAAGG - Intergenic
911069339 1:93819960-93819982 TTGAGTACACATGGACACAAAGG - Intronic
911252779 1:95597076-95597098 TTGAGTACACATGGACACAAAGG + Intergenic
913278330 1:117160644-117160666 TTTGATACAGACAGACAGAATGG - Intronic
913689954 1:121269570-121269592 TTTGGTACACATAAACAGAAGGG + Intronic
914147646 1:145010702-145010724 TTTGGTACACATAAACAGAAGGG - Intronic
916232185 1:162551383-162551405 TTGTGTATACACACACATACAGG + Intergenic
917867216 1:179208344-179208366 TTGAGTACAAATGGACATAAAGG - Intronic
920477275 1:206288047-206288069 TTTGGTACACATAAACAGAAGGG + Intronic
920911384 1:210220658-210220680 TTTGGCACACACACACAAAAGGG - Intergenic
921394581 1:214654960-214654982 TTGGATAAATACAGACATAGTGG + Intronic
923080657 1:230650989-230651011 TTTGAAACACACAGACATACAGG + Intronic
924102290 1:240617296-240617318 ATGGATACACACAGAAACAAAGG - Intergenic
1064515870 10:16147318-16147340 TTGGGTACACATGGGCACAAAGG + Intergenic
1064676968 10:17770028-17770050 TTGGGTACTCATGGACATAAAGG - Intronic
1065157830 10:22888531-22888553 CTGGGTACACAATGAAATAAAGG + Intergenic
1065193475 10:23237076-23237098 TTGAGTACACATGGACACAAAGG - Intronic
1066016246 10:31246722-31246744 TTGGGTGCACATGGACATAAAGG - Intergenic
1067390787 10:45861518-45861540 ATGTGTACACACATACATATAGG + Intergenic
1067496807 10:46768104-46768126 TTTGGTGCACAGAGATATAAGGG + Intergenic
1067500684 10:46802332-46802354 ATGTGTACACACATACATATAGG - Intergenic
1067593900 10:47537568-47537590 ATGTGTACACACATACATATAGG + Intronic
1067597846 10:47572299-47572321 TTTGGTGCACAGAGATATAAGGG - Intergenic
1067641011 10:48045681-48045703 ATGTGTACACACATACATATAGG + Intergenic
1067654027 10:48177510-48177532 TTGGGTAAACACAGTTATATGGG + Intronic
1067872492 10:49974586-49974608 ATGTGTACACACATACATATAGG - Intronic
1068100929 10:52551900-52551922 ATGGGTACCCACAGACATAGAGG - Intergenic
1068137927 10:52969225-52969247 TTGGATACACATAGACACAAAGG - Intergenic
1070137973 10:73711735-73711757 ATGTGTACACACAAACATATAGG + Intergenic
1070234750 10:74611667-74611689 ATGGGTATACATGGACATAAAGG - Intronic
1070432581 10:76356028-76356050 TTGGCTACACCCAGATATATTGG + Intronic
1071122605 10:82296977-82296999 ATGGGTACACATGGACATAAAGG - Intronic
1071615493 10:87071598-87071620 TTTGGTACACAGAGATATAAGGG + Intronic
1073472562 10:103731927-103731949 TTGGGTGCAGTCAGACTTAAGGG - Intronic
1075162519 10:120037049-120037071 TTGGGTACACAGAGACAGAGGGG + Intergenic
1078034748 11:7791555-7791577 CTGTGTACACACACACACAATGG + Intergenic
1078044549 11:7901456-7901478 TTGAGTACACATGGACACAAAGG - Intergenic
1079473175 11:20799900-20799922 TTGAATACACATAGACATAAAGG - Intronic
1079828284 11:25227448-25227470 TTGGATTCACACAGAAATATTGG - Intergenic
1080714055 11:34781142-34781164 CTGAATACACATAGACATAAAGG - Intergenic
1081022683 11:37967581-37967603 TTGGGTACACATGGACATAAAGG + Intergenic
1081105631 11:39065387-39065409 ATGGGGACACAGAGACATAGAGG + Intergenic
1081476768 11:43440916-43440938 TTGTCTACACACATACATACAGG - Intronic
1082901517 11:58258512-58258534 GTGGGTACACAAAGGCATACAGG - Intergenic
1086039996 11:82464589-82464611 CTGAGCACACACGGACATAAAGG - Intergenic
1087356554 11:97100976-97100998 TTGGGTAAACAATGAAATAAAGG + Intergenic
1087598982 11:100288509-100288531 CTGGGTACACAAAGAAATGAAGG + Intronic
1087937865 11:104056498-104056520 TTTGGGACACAGAGACACAACGG + Intronic
1088490796 11:110386028-110386050 TTGGGTACATAAAGAAATGAAGG - Intergenic
1088508033 11:110545178-110545200 TTGGGTAAACAAAGAAATTAAGG + Intergenic
1089194513 11:116686274-116686296 ATGGGTAAGAACAGACATAATGG + Intergenic
1090096635 11:123748412-123748434 TTGAGTACACACGGACACCATGG - Intergenic
1090742014 11:129670996-129671018 CTGGGTACACATGAACATAAAGG - Intergenic
1090960128 11:131548857-131548879 TTGGGGACACTGAGACAGAAAGG + Intronic
1091328246 11:134708629-134708651 ATGGGTACACAAAGGCATACAGG - Intergenic
1093341533 12:17981021-17981043 ATGGATACAAACAGACATATGGG + Intergenic
1093952854 12:25183179-25183201 ATGGGTACACATGGTCATAAGGG + Intronic
1094143964 12:27209586-27209608 GTGGGTACACAAAGGCATACAGG + Intergenic
1095110664 12:38291790-38291812 TGAGGAAAACACAGACATAACGG - Intergenic
1096348842 12:50877002-50877024 GTGGGTACTCATGGACATAAAGG + Intronic
1098270949 12:68769706-68769728 TTGGGAACAGAAAGACAAAACGG - Exonic
1099278979 12:80618077-80618099 TTGGGTACTAAGAGAAATAAAGG - Intronic
1099337235 12:81377999-81378021 TTGGGGACACAGAGATATACCGG + Intronic
1099753241 12:86805409-86805431 CTGGGTACTCATAGACATAAAGG - Intronic
1101289686 12:103355159-103355181 CTGGGTATACACAGACATATTGG - Intronic
1103223381 12:119265770-119265792 TTGGGTACACACAGACATAAAGG + Intergenic
1104216070 12:126735133-126735155 TTGGATACTCACAGAAAGAATGG + Intergenic
1105423989 13:20278283-20278305 TTGGGTACTCATGGACATAAAGG + Intergenic
1105802541 13:23920893-23920915 TTGGGTACTCATAGACATAAAGG + Intergenic
1106688277 13:32085746-32085768 TTGTGTTCACGCAAACATAATGG + Intronic
1107240198 13:38223705-38223727 TTGGGAACACAGAGAGGTAATGG + Intergenic
1107492052 13:40889854-40889876 TTGGGTACATAACGAAATAAAGG + Intergenic
1108104435 13:46993367-46993389 ATGGATACACATGGACATAAAGG - Intergenic
1108467305 13:50729223-50729245 TTGAGTACACATAGACATAAAGG - Intronic
1108800453 13:54089351-54089373 TTGAGTACACACTGAAATTAAGG - Intergenic
1109691882 13:65905350-65905372 CTGAGTACACATAAACATAAAGG - Intergenic
1111778401 13:92692069-92692091 TAGGGTACACATGGATATAAAGG - Intronic
1111955716 13:94756084-94756106 TTGAGTACACATGGACACAAAGG - Intergenic
1111974800 13:94954546-94954568 TTGCATACTCACAGACATAAAGG + Intergenic
1112312793 13:98334379-98334401 TTTGATACACACAGGCAGAAGGG + Intronic
1112322660 13:98421498-98421520 TTGAGAACATACAGAAATAAAGG - Intronic
1112372183 13:98803585-98803607 TTGGGTAACCACTGACTTAAAGG + Intronic
1112813618 13:103248198-103248220 ATGGGTACACACGTACATAGAGG - Intergenic
1116085001 14:40224361-40224383 TTGGGTACACATGGACACAAAGG + Intergenic
1117505997 14:56403604-56403626 TTGGATACACATGGACACAAAGG - Intergenic
1117833891 14:59781913-59781935 TTGGGGACACACAAACATACAGG - Intronic
1118268771 14:64321858-64321880 TTGAATACACATAAACATAAAGG + Intronic
1121071458 14:91026029-91026051 ATTGGTACACAGGGACATAAAGG - Intronic
1202832672 14_GL000009v2_random:53830-53852 TTGGGTGCACATTGTCATAAAGG + Intergenic
1123488373 15:20760954-20760976 CTGGGAACACACAGCCATCAGGG - Intergenic
1123544870 15:21330027-21330049 CTGGGAACACACAGCCATCAGGG - Intergenic
1126551861 15:49940344-49940366 TTGGGTACACATAGTCATAAAGG + Intronic
1127688317 15:61370123-61370145 TTGGATACACTGAGAGATAAGGG + Intergenic
1129695117 15:77736220-77736242 TGAGGTGCACACAGACATAGGGG + Intronic
1131626762 15:94128546-94128568 ATGGGTACACATGAACATAAAGG - Intergenic
1131836313 15:96395168-96395190 TGGGGTACACACGGACAGATTGG + Intergenic
1132113524 15:99119341-99119363 TTGGGCCCACCCAGACATACTGG + Intronic
1202953216 15_KI270727v1_random:57298-57320 CTGGGAACACACAGCCATCAGGG - Intergenic
1133535860 16:6701897-6701919 CTGAGTACACACGGACACAAAGG + Intronic
1134590521 16:15449318-15449340 TTGGGTACAAATGGACACAAAGG + Intronic
1136004938 16:27323021-27323043 GTGGGGACACACAGACATGGGGG - Intronic
1137483680 16:48874097-48874119 TTGGGTACACATGGACCTAAAGG + Intergenic
1137503683 16:49031585-49031607 CTGGGTACACAAAGAAATGAAGG + Intergenic
1137808803 16:51332690-51332712 CTGGGTACACAAAGAAATGAAGG + Intergenic
1137994873 16:53199648-53199670 ATGGGTATACATAGACATACAGG - Intronic
1138722608 16:59099295-59099317 TTGGGTACATAACGACATGAAGG + Intergenic
1138803801 16:60068723-60068745 TTGGGTGCAAACAGAAAAAAAGG - Intergenic
1140630003 16:76840384-76840406 TTGAGTACACATAGACACAAAGG - Intergenic
1140891935 16:79292271-79292293 GTGATTACACACAGACATACAGG + Intergenic
1141053026 16:80789859-80789881 AAGGGTACACATGGACATAAAGG + Intronic
1142992836 17:3743237-3743259 TTGTGAACATAAAGACATAAAGG + Intronic
1144459876 17:15449753-15449775 ATGTGTACACATGGACATAAAGG - Intronic
1144750314 17:17644065-17644087 TTGGACACACACACACATAGAGG + Intergenic
1149113906 17:53068239-53068261 GTGGGTACACATGGACATAGTGG + Intergenic
1149254647 17:54811882-54811904 ATGGATACACACAGACATTAAGG + Intergenic
1149377134 17:56055465-56055487 ATATATACACACAGACATAATGG - Intergenic
1153360785 18:4194199-4194221 TTGGGTACTCATGGGCATAAAGG - Intronic
1153860200 18:9195132-9195154 TTGAGTACACATGGACATGAAGG + Intronic
1155230452 18:23768936-23768958 TTGGGTACTCATGGACATAAAGG + Intronic
1155385211 18:25269691-25269713 TTGGGTACATAAAGAAATGAAGG + Intronic
1156317845 18:35987554-35987576 TGGTGTACACACACACACAATGG + Intronic
1156542505 18:37928901-37928923 ATGACTACACACGGACATAAAGG - Intergenic
1156578329 18:38346087-38346109 TTGAGTACACATGGACACAAAGG + Intergenic
1157796032 18:50576437-50576459 TTGAGTACACATGGACACAAAGG + Intronic
1158709607 18:59825653-59825675 TTGGGTACACATGGACATAAAGG - Intergenic
1158751769 18:60270298-60270320 GTGGATACACATGGACATAAAGG - Intergenic
1159417908 18:68177580-68177602 TTGGGTACTCATAGATATAAAGG + Intergenic
1159641395 18:70866473-70866495 TTGGGTACTCATGGACATAAAGG - Intergenic
1159715363 18:71814993-71815015 TTGAGTATACAAGGACATAAAGG + Intergenic
1159864403 18:73687313-73687335 TTACCTACACACAGAAATAAAGG - Intergenic
1159864754 18:73690850-73690872 TTGGCTACAGGCAGATATAAAGG - Intergenic
1159934349 18:74350465-74350487 TTGGATACAGACACACATAGAGG + Intronic
1161698361 19:5782621-5782643 TTGGAGACACACAGCCATCAGGG - Intergenic
1164444160 19:28302928-28302950 CTGGGAACACATGGACATAAAGG + Intergenic
1165872831 19:38985350-38985372 TTGGGTAGACACAAACATTCAGG - Intergenic
1202640009 1_KI270706v1_random:73901-73923 TTGGGTGCACATTGTCATAAAGG - Intergenic
925521631 2:4753007-4753029 TTGGGAAAACACACAGATAAGGG - Intergenic
925547275 2:5030472-5030494 TTGGGTACTCGTGGACATAAAGG - Intergenic
929127634 2:38535856-38535878 TTATGTACACACATACATGAAGG + Intergenic
930147232 2:48019746-48019768 TTGAGTACACAAGGACACAAAGG + Intergenic
930209802 2:48623859-48623881 TTGGGTACATACAGACAGAAAGG + Intronic
930748827 2:54912605-54912627 TTGGGTACACACAGACAGGAAGG - Intronic
931929862 2:67119637-67119659 TTGAGTACACATAGACACAAAGG + Intergenic
932372514 2:71203156-71203178 TTGTGTATACACAAACATATGGG - Intronic
932554281 2:72806221-72806243 TTAAGTACACATGGACATAAAGG - Intronic
932936000 2:76102101-76102123 TTGGGTACTCATAGACATAAAGG + Intergenic
933498238 2:83078389-83078411 TTGAGTACACATAGACACAAAGG - Intergenic
933638648 2:84735092-84735114 TTGGGTACACACAGACATAAAGG - Intronic
933644864 2:84802961-84802983 TTGGGTAAACAAAGAAATTAAGG + Intronic
935861098 2:107330490-107330512 TTGAGTACACATGGACATAAAGG - Intergenic
935861114 2:107330604-107330626 TTGAGTACACATGGACATAAAGG - Intergenic
936176334 2:110223852-110223874 TGGTGTAAAGACAGACATAATGG - Intergenic
937076773 2:119112937-119112959 TTGGGGACACACAGAGTTAGAGG + Intergenic
937154978 2:119712494-119712516 TTGGATACACAGAGACACCAGGG + Intergenic
937725446 2:125159239-125159261 TTGGGTAAATAATGACATAAAGG + Intergenic
938625900 2:133108890-133108912 GTGTATACACACAGACACAATGG - Intronic
941733786 2:168949395-168949417 ATGGGTAAACATAGACATACAGG - Intronic
942010207 2:171754663-171754685 TTGGGAAGATACACACATAATGG + Intergenic
942762575 2:179417043-179417065 TTGGGTACACATGAACACAAAGG + Intergenic
943086651 2:183319923-183319945 AAGGGTACACATATACATAAAGG - Intergenic
943138036 2:183940496-183940518 TTGGGTCAACAAAGACATCAAGG + Intergenic
943356749 2:186865781-186865803 CTGGGTAGACAGGGACATAATGG + Intergenic
944361009 2:198856538-198856560 CTGGGTATTCACAGACATAAAGG + Intergenic
944918725 2:204388494-204388516 TTGGGAACACAAAGAATTAATGG - Intergenic
946152186 2:217783747-217783769 TTGGCTACAAACAGGAATAAGGG + Intergenic
946665095 2:222041210-222041232 CTGGGTTGACACAGACATGAAGG + Intergenic
947250482 2:228097701-228097723 TTGGGTACACATGGACATAAAGG - Intronic
947349099 2:229223975-229223997 ATGGGTACATATGGACATAAAGG - Intronic
1169177300 20:3528539-3528561 TTGAGTACACATGGACACAAGGG + Intronic
1170678804 20:18507004-18507026 TTGGGCACACATGGACACAAAGG + Intergenic
1173029368 20:39340681-39340703 TTGGGTACTCATGGACATAAAGG + Intergenic
1173076113 20:39821434-39821456 TTGGGTATGCAGTGACATAAAGG - Intergenic
1173214524 20:41068186-41068208 TTGGGGACAAAGAGAGATAAAGG - Intronic
1176648340 21:9371493-9371515 TTGGGTGCACATTGTCATAAAGG - Intergenic
1178711995 21:34925456-34925478 ATGGGAAGACACAGACACAATGG + Intronic
1179253273 21:39692159-39692181 CTGAGTACACACGGACACAAAGG - Intergenic
1180361932 22:11907998-11908020 TTGGGTACACATTGTCATAAAGG + Intergenic
1181121732 22:20671656-20671678 TTGGATACATACAGAAATATAGG - Intergenic
1182611544 22:31552072-31552094 GTTGGTACACACAGACATAAAGG - Intronic
1183155670 22:36073017-36073039 TTGGGTACAGACAGACAGCAGGG - Intergenic
949209463 3:1480363-1480385 CTGGGTACATACAGAAATGAAGG + Intergenic
949765951 3:7525749-7525771 TTGGATACACATGGACATAAAGG - Intronic
950162609 3:10771696-10771718 TTCGGTACACACTGTCATAGAGG - Intergenic
951260136 3:20497432-20497454 TTGGGTACACACAAACATGAAGG - Intergenic
951674002 3:25216534-25216556 TTGAGAACACATAGACACAAAGG + Intronic
952280194 3:31915556-31915578 TTGGGTACTAATGGACATAATGG + Intronic
955795216 3:62629259-62629281 TTGACTACAAACAGACACAAAGG - Intronic
956330319 3:68099946-68099968 TTAGGTACACATGGACATAAAGG + Intronic
958438654 3:94129444-94129466 TCGAGTACACATGGACATAAAGG + Intergenic
958553807 3:95647949-95647971 CTGGGTACATAAAGAAATAAAGG + Intergenic
959800962 3:110495086-110495108 TTGGGCAGACACAGACCTACTGG + Intergenic
960480517 3:118182527-118182549 TTGGGTACACATGGACATAAAGG - Intergenic
961772470 3:129260134-129260156 CTGGGTGCTCACAGACATTATGG + Intronic
962056539 3:131877771-131877793 TTGGGGACACATATACAAAATGG + Intronic
962405025 3:135093225-135093247 TTGGGGACACAGAGACATGATGG + Intronic
963505601 3:146180931-146180953 TTTGTTACACACACACATGAGGG + Intergenic
965327256 3:167322538-167322560 TTGTATAAACACATACATAAAGG + Intronic
965394499 3:168145517-168145539 TTGGGTCCACAAAGAAATTAAGG - Intergenic
965504783 3:169502429-169502451 TTGGGAGCACACAGAATTAAAGG - Intronic
966340524 3:178920792-178920814 ATGGGTACATATGGACATAAAGG + Intergenic
1202738542 3_GL000221v1_random:33491-33513 TTGGGTGCACATTGTCATAAAGG + Intergenic
971232595 4:24812035-24812057 TTGTGCACACACAGAAAAAAAGG - Intronic
971479323 4:27100114-27100136 TGGGAGACACACAGACATACAGG - Intergenic
971583387 4:28372747-28372769 ATGGGTACACAAAGGCATAAAGG + Intronic
972098988 4:35388378-35388400 TTTGATACACATAGACATAAAGG + Intergenic
972453497 4:39228996-39229018 ATGGGTACACATGGACATACAGG - Intronic
973978757 4:56288417-56288439 TTGGGAACACACAGACATTAGGG - Intronic
974141844 4:57897977-57897999 CTGGGTACATACAGAAATGAAGG - Intergenic
974496580 4:62636132-62636154 TTGAGTACACAGAGATATAAAGG + Intergenic
974508098 4:62803542-62803564 TTGGGTAAACAAAGAAATTAGGG - Intergenic
974703080 4:65476529-65476551 TTGGGAACTCATTGACATAAAGG + Intronic
974977417 4:68907169-68907191 TTGAGTACACTCAGACCCAACGG + Intergenic
975390085 4:73805775-73805797 TTGGGTAAACAAAGAAATTAAGG + Intergenic
975933021 4:79549708-79549730 TTGGGTAAACAATGACATCAAGG + Intergenic
975941282 4:79649850-79649872 TTGGGTACTCATGGACATAAAGG - Intergenic
976563337 4:86526798-86526820 TTGGGTAAACAAAGAAATCAAGG - Intronic
977287701 4:95129429-95129451 TTAGGCACATACAGAAATAAAGG - Intronic
977482839 4:97600036-97600058 TTGAGTACACATGGACACAAAGG + Intronic
977590756 4:98824020-98824042 ATGGGTACATACAGACAGAAAGG + Intergenic
978523175 4:109637534-109637556 TAGTGTACACACACACACAATGG + Intronic
979050451 4:115923492-115923514 TGGAATACACACATACATAATGG - Intergenic
979463564 4:121010350-121010372 TTGGGTATAAAAAGACAAAAGGG + Intergenic
979945054 4:126818970-126818992 TTAGGTACACAAAGACTTTAAGG + Intergenic
980282042 4:130735286-130735308 TTGGGTACTCATGAACATAAAGG + Intergenic
980576139 4:134685368-134685390 TTGGGTAAACACAGAAATTAAGG - Intergenic
980666002 4:135936349-135936371 TTGGGTACACACAGACACAAAGG + Intergenic
981348018 4:143698722-143698744 GTGGCTACAGAGAGACATAATGG - Exonic
982661051 4:158207532-158207554 ATGGGTACACATGGACATAAAGG - Intronic
983339372 4:166438661-166438683 TTGGGTACAAATGGACATAAAGG - Intergenic
983850532 4:172575035-172575057 TTGGGTACACACAGTCGTGATGG - Intronic
984308457 4:178025247-178025269 TTGGATACTCACATCCATAAAGG + Intergenic
985415237 4:189729975-189729997 AGGGGTCCACACAGACAGAAAGG + Intergenic
1202767369 4_GL000008v2_random:159760-159782 TTGGGTGCACATTGTCATAAAGG - Intergenic
986733341 5:10650573-10650595 ATGAGTTCACACAGACATCATGG + Intergenic
987883720 5:23784080-23784102 ATTTGTACACACATACATAAAGG - Intergenic
987964622 5:24855551-24855573 CTGGGTACTCACAGAGATACTGG - Intergenic
987994151 5:25253065-25253087 TTGGGTATACACTCAAATAATGG - Intergenic
988872553 5:35406764-35406786 TTGGGTATGCATAGACATACAGG - Intergenic
989213113 5:38877266-38877288 TTGGGTACACACATACAGCATGG + Intronic
989366066 5:40657446-40657468 ATGGGTACACAAAGACATGCAGG + Intergenic
989545972 5:42673720-42673742 TTGGGTAAACATGGATATAAAGG + Intronic
990612935 5:57477411-57477433 TTGGGTACTCATGGACATAAAGG + Intergenic
990880753 5:60535023-60535045 GTGTGTACACACATACACAATGG - Intergenic
990972515 5:61524676-61524698 TTGGCTGAGCACAGACATAAGGG - Intronic
991566707 5:68012336-68012358 TTAGGTATACAGAGAGATAAAGG + Intergenic
993218064 5:85050827-85050849 TTAGGTACTCATGGACATAAAGG + Intergenic
994906385 5:105845222-105845244 TTTGGTACACCCTGACAAAAAGG - Intergenic
996940803 5:129002987-129003009 TCGGGTGCACATAGAAATAAAGG - Intronic
996963700 5:129282438-129282460 ATGGGTACACATGGGCATAAAGG - Intergenic
999597953 5:153226375-153226397 TTGAGTACACATGGACACAAGGG - Intergenic
1000842035 5:166231968-166231990 TTGGTTAAACACAGGCATAGAGG - Intergenic
1000908601 5:166994023-166994045 ATATGTACACACAGACATAATGG - Intergenic
1001377177 5:171272141-171272163 TTGAGTACACATGGACATGAAGG + Intronic
1001657895 5:173367100-173367122 TTGAGTACACATGGACACAAAGG - Intergenic
1003683271 6:8276685-8276707 ATGGGTACGCATAGACATAGAGG + Intergenic
1004058123 6:12161668-12161690 TGGGGTACACACGGACCCAATGG + Exonic
1005054100 6:21713751-21713773 TGGTGTACACACACACATACAGG - Intergenic
1005192746 6:23244403-23244425 TTGGGGATACACTGCCATAAAGG - Intergenic
1005210488 6:23454899-23454921 TAGGGAAGACACAGAGATAAGGG + Intergenic
1005518631 6:26578335-26578357 TTGAGTACACACAGACACAAAGG - Intergenic
1006082470 6:31575356-31575378 TTGGGGACACACAAGCATCAAGG - Intergenic
1006805297 6:36784491-36784513 TTGGGTTCACACATATATCAAGG - Intronic
1008298990 6:49811192-49811214 TTGGATACACACAAACTCAAAGG + Intergenic
1008341760 6:50374159-50374181 TTGAGTACACATAGATTTAAAGG - Intergenic
1008642190 6:53475398-53475420 TTGGAGACACACAGACACACAGG - Intergenic
1009482796 6:64180995-64181017 TTGGGTACACATGGACACGAAGG - Intronic
1009572031 6:65397414-65397436 ATGGGTACACATTGACATACAGG - Intronic
1009684719 6:66942582-66942604 TTTAGTACACATAGACATAGAGG + Intergenic
1010023040 6:71183437-71183459 TTGGGTAAACAAAGAAATTAAGG + Intergenic
1010134963 6:72540921-72540943 TTGGGTACTCATGTACATAAAGG - Intergenic
1010549485 6:77203449-77203471 ATGAGTACTCACGGACATAAAGG + Intergenic
1010739497 6:79483293-79483315 AAGGATACACACAGACATTAAGG + Intergenic
1012881738 6:104799343-104799365 TTAGGCAAACACACACATAAGGG + Intronic
1014005480 6:116412890-116412912 TTGGGTACACATGGACATACAGG - Intronic
1014281658 6:119448357-119448379 TTGTGTACACACACACTTAATGG + Intergenic
1014466665 6:121764368-121764390 TTGAGTACACATGGACACAAAGG + Intergenic
1017049118 6:150374047-150374069 TGGGGTACCCAAAGAGATAAAGG + Intronic
1017342123 6:153336165-153336187 TTGGGTAAATACAGCCAGAAGGG - Intergenic
1017971748 6:159317803-159317825 TTCGGTTGACACAGACATTAAGG + Intergenic
1018006790 6:159629803-159629825 TTGGGTACTCATGGATATAAAGG - Intergenic
1020240241 7:6388828-6388850 AAGTGTACACAAAGACATAAGGG - Intronic
1020409713 7:7877539-7877561 TAAGGTGCAAACAGACATAAAGG - Exonic
1020446680 7:8276178-8276200 TTGTGTACACATAGACATAGTGG - Intergenic
1020505932 7:8987633-8987655 ATGGGTAGACACAGATATATAGG - Intergenic
1021327958 7:19297701-19297723 ATGGGAACACATAGACACAAAGG + Intergenic
1021702960 7:23338093-23338115 AAGGGTAAAAACAGACATAACGG + Intronic
1022705123 7:32795131-32795153 ATGTGTAGACACAGACATACAGG + Intergenic
1024103646 7:46059236-46059258 TTGGGTCCTCAGAGACATGATGG + Intergenic
1024207229 7:47174219-47174241 TTGGGTGCACAGAGACAGCATGG - Intergenic
1024283854 7:47740198-47740220 ATGTGTACACACACACACAATGG + Intronic
1025038736 7:55620485-55620507 TTGGGTACACATGGACAAGATGG + Intergenic
1025061108 7:55809209-55809231 TTGAGAACACATAGACACAAAGG + Intronic
1027449923 7:78319528-78319550 CTGGGTACATAAAGAAATAAAGG + Intronic
1027736826 7:81942920-81942942 TGGAGTACACATAGACACAAAGG + Intergenic
1028067527 7:86406022-86406044 TTGGGTAGACATGGACACAAAGG + Intergenic
1028817279 7:95160718-95160740 TTGGGAACTCATGGACATAAAGG - Intronic
1033522688 7:142177563-142177585 CTGGGTACACATAGATATAAAGG - Intronic
1033869808 7:145738166-145738188 TTGGGTACACATGGACATGAAGG + Intergenic
1033898182 7:146101622-146101644 TTGAGTACACAAAGGCATACAGG - Intergenic
1036710977 8:11078432-11078454 TGGGGAACACACAGGCAGAATGG - Intronic
1037792046 8:21953424-21953446 TTGGCTACAAAAAGACATAGAGG - Intronic
1038274278 8:26107589-26107611 TTGGATAAACACACAAATAATGG + Intergenic
1039069953 8:33640758-33640780 TTGGGGAGACCCAGACATCATGG + Intergenic
1039270231 8:35872516-35872538 ATGGGAAAACACAGACATGATGG + Intergenic
1039785417 8:40830373-40830395 ATGGGTACACGTAGACATAAAGG - Intronic
1040914415 8:52554714-52554736 TGGGGTACACAAACACTTAAAGG + Intronic
1040985470 8:53289729-53289751 TTGGGTACTCATGGACACAAAGG + Intergenic
1041963037 8:63641751-63641773 ATGGGTAGACACAGTCTTAATGG - Intergenic
1042179057 8:66066671-66066693 ATGGGTACACAAAGGCATACAGG + Intronic
1042473388 8:69216907-69216929 TTGGGTACATAATGACATTAAGG + Intergenic
1043225973 8:77730586-77730608 TTGAGAACACACACACAAAAAGG + Intergenic
1046278514 8:111993498-111993520 TTAGGCACACAGAGACATCAGGG - Intergenic
1046756320 8:117976473-117976495 ATGGATCCTCACAGACATAATGG + Intronic
1046889634 8:119408367-119408389 TTGAGTATTCACGGACATAAAGG + Intergenic
1047526870 8:125641365-125641387 AAGGGTGGACACAGACATAAGGG - Intergenic
1048124701 8:131620977-131620999 TTGGGTACTCATGGACATGAAGG + Intergenic
1048787613 8:138067094-138067116 TGAGGTACACACACACCTAATGG - Intergenic
1049057394 8:140249222-140249244 TTGAGTCCTCACAGACATAAAGG - Intronic
1049097109 8:140555309-140555331 TTGGTTACACACTGATAAAAAGG + Intronic
1050254253 9:3777579-3777601 TTGGGTACATAAAGACAAATGGG + Intergenic
1050869613 9:10550626-10550648 TTGGGTGCACACAAACCCAAAGG + Intronic
1051088323 9:13377997-13378019 TTGTGTACATAAAGACATCAAGG - Intergenic
1051141427 9:13983625-13983647 TTGGTGACACACAGTCAAAATGG + Intergenic
1051787630 9:20762864-20762886 TTGGGTTCACACAGACATGAAGG - Intronic
1052892347 9:33713691-33713713 CTGGGTACACATGAACATAAAGG - Intergenic
1053064815 9:35060602-35060624 TTGGGTACACCATGAAATAATGG - Intronic
1053163665 9:35829805-35829827 TTGGGTAAACACAGAGATGAGGG - Exonic
1054788048 9:69228305-69228327 TTGGGTACAAATGGACATAGAGG + Intronic
1054932463 9:70650105-70650127 TTGAGTACACATGGACACAAAGG + Intronic
1055337693 9:75249240-75249262 TTGGGTAAACAATGAAATAAAGG - Intergenic
1056588931 9:87949958-87949980 TTAGGTACAAATGGACATAAAGG - Intergenic
1058838820 9:108885782-108885804 CTGGATCCACACAGACATGAGGG + Intronic
1058945555 9:109852300-109852322 TTGGGTACACACAGACACAAAGG - Intronic
1058984400 9:110197808-110197830 CTGTGTAAACACAGACAGAAGGG + Intronic
1059349743 9:113656213-113656235 TTGTGCACACACACACACAATGG - Intergenic
1059611813 9:115906026-115906048 ATGTCTACACAAAGACATAAGGG - Intergenic
1203707274 Un_KI270742v1:63938-63960 TTGGGTGCACATTGTCATAAAGG + Intergenic
1185829344 X:3284919-3284941 TTGAGTACACATGGACACAAAGG - Intergenic
1185921680 X:4100052-4100074 TTGGGTACACATGGACACAAAGG - Intergenic
1186273587 X:7916746-7916768 CTGGCGACCCACAGACATAAAGG + Intronic
1187080278 X:15979004-15979026 GTGGGTACACAAAGGCATACAGG + Intergenic
1187991850 X:24882510-24882532 TTGGGTACACATGAACATAAAGG - Intronic
1188676089 X:32941601-32941623 TTGGGTACTCATGGACATAAAGG + Intronic
1189036307 X:37496558-37496580 TTGGGTCCTCAAAGAAATAAGGG + Intronic
1189150914 X:38705575-38705597 CTGAGTACACACACACAAAATGG + Intergenic
1189173165 X:38929046-38929068 TTGAGTACTCATGGACATAAAGG + Intergenic
1191865339 X:65699213-65699235 TTGGGAACACTCAGACCTACAGG + Intronic
1192488126 X:71548706-71548728 TTGGGTACACATGGACACAAAGG + Intronic
1192655651 X:72990907-72990929 ATGGGTACACATGGACATAAAGG + Intergenic
1192718313 X:73666206-73666228 TTGGGTACATAAAGAAATTAAGG - Intronic
1192769215 X:74169531-74169553 CTGGGTACACATAGATATAAAGG + Intergenic
1192938716 X:75889806-75889828 TTAGGTTCACACAAATATAACGG - Intergenic
1192988340 X:76424740-76424762 TTGGGTACTCATCAACATAAAGG + Intergenic
1193461334 X:81793960-81793982 CTGGGTACATAAAGAAATAAAGG + Intergenic
1193461711 X:81797929-81797951 TTAGGTACTCATGGACATAAAGG - Intergenic
1193482953 X:82049668-82049690 TTGGGTAAATAAAGAAATAAAGG + Intergenic
1193725910 X:85039143-85039165 TTGGGTACACAATGAAATTAGGG - Intronic
1193934087 X:87594141-87594163 CTGGGTTCTCACAGACAGAATGG + Intronic
1196215476 X:113046785-113046807 GTTGGAACTCACAGACATAAAGG + Intergenic
1196568501 X:117237382-117237404 TTGGGTAAACAAAGAAATTAGGG - Intergenic
1196992223 X:121342907-121342929 GTGGGAACACACATACATATGGG + Intergenic
1197962318 X:132020563-132020585 TTTGTTACACACACACACAAAGG - Intergenic
1198340573 X:135709660-135709682 ATGGGTACACATGAACATAAAGG + Intergenic
1198342655 X:135730297-135730319 ATGGGTACACATGAACATAAAGG + Intergenic
1198345334 X:135752998-135753020 ATGGGTACACATGAACATAAAGG - Intergenic
1198431004 X:136566022-136566044 TTGGCTACACACAGACACAAAGG - Intergenic
1198557770 X:137814080-137814102 TTAGCTACACATGGACATAAAGG + Intergenic
1198579825 X:138050928-138050950 TTGGGTAAACAATGACATTAAGG + Intergenic
1198868580 X:141152258-141152280 TTGGGCACACAGAGACACAAGGG - Intergenic
1199644400 X:149892422-149892444 TTGAGTATACACGGACACAAAGG + Intergenic