ID: 933650830

View in Genome Browser
Species Human (GRCh38)
Location 2:84848943-84848965
Sequence ATTTCCTTCAGAAACAGTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 367
Summary {0: 1, 1: 0, 2: 3, 3: 47, 4: 316}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933650830_933650836 22 Left 933650830 2:84848943-84848965 CCTTCACTGTTTCTGAAGGAAAT 0: 1
1: 0
2: 3
3: 47
4: 316
Right 933650836 2:84848988-84849010 TAGGATAACATCAATGACTGAGG 0: 1
1: 0
2: 1
3: 3
4: 120
933650830_933650831 3 Left 933650830 2:84848943-84848965 CCTTCACTGTTTCTGAAGGAAAT 0: 1
1: 0
2: 3
3: 47
4: 316
Right 933650831 2:84848969-84848991 GCCCGAGCTATCCTAGCCATAGG 0: 1
1: 0
2: 0
3: 2
4: 28

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933650830 Original CRISPR ATTTCCTTCAGAAACAGTGA AGG (reversed) Intronic
900949060 1:5847417-5847439 AAGTCCTTGAGAAACAGTGCTGG + Intergenic
901866356 1:12109527-12109549 AGTGCCTTCAGAATCAGTGTTGG - Intronic
905314830 1:37075635-37075657 ATTGCCCTCAGAAGCAGTGTGGG - Intergenic
907017868 1:51034818-51034840 GTTTCTTTGAAAAACAGTGAGGG + Intergenic
907752612 1:57277601-57277623 ATGTCATTCTGAAGCAGTGATGG - Intronic
907797232 1:57729714-57729736 AATTTCGTCAGCAACAGTGAGGG + Intronic
908052137 1:60245004-60245026 CTTTCCTTTAGAAACAGAGGTGG - Intergenic
908158384 1:61380285-61380307 ATTTCCTCCAGAAAAAGAGTAGG + Intronic
908424236 1:63990213-63990235 ATTCCCTTCAGCAACAGAAAAGG - Intronic
908941249 1:69437098-69437120 AGGTATTTCAGAAACAGTGAAGG - Intergenic
909021459 1:70435901-70435923 ATTTGCATCAGAAACAGTGAGGG + Intronic
909255281 1:73412840-73412862 CTTTCCTTCAGCAACAGTAAAGG + Intergenic
909581335 1:77239214-77239236 ACTTACTTGAGAAGCAGTGAAGG - Intergenic
909992631 1:82241283-82241305 ATTTCCTACAGCAGCAGTCAAGG + Intergenic
910895800 1:92068120-92068142 ATTTTTTTCTGCAACAGTGAGGG - Intergenic
911532717 1:99064720-99064742 ATTTCTTTCCAAAACAGTGAAGG - Intergenic
912642848 1:111363628-111363650 ATTTCCTACAGAGAGAGTGAGGG + Intergenic
912645432 1:111387680-111387702 ATTTCCTAAATAAACACTGAGGG + Intergenic
914358575 1:146910022-146910044 GTTTCCATCAGAATCAGTGTGGG + Intergenic
914494849 1:148186985-148187007 GTTTCCATCAGAATCAGTGTGGG - Intergenic
916177279 1:162053017-162053039 ATTTCTTTCTGGACCAGTGAAGG + Intergenic
917581281 1:176380455-176380477 ATATCTTTCAGAAAGAGGGATGG + Intergenic
919015436 1:192027498-192027520 ATATCCTTGACAAACATTGATGG - Intergenic
919212554 1:194507447-194507469 TTTTCCTTCAGAATCACTGAAGG + Intergenic
920581916 1:207117758-207117780 TTTTCCTTCAGGTACAGGGAAGG + Intronic
921841760 1:219836135-219836157 ATTTCCTGCAGAAAGAGGCAAGG + Intronic
923028697 1:230228961-230228983 ATATCCTTCATAAATATTGAAGG - Intronic
923621141 1:235580586-235580608 ATTTGGTTCAGAAACAGAGTTGG - Intronic
924083727 1:240426650-240426672 ATTTCCTTCAAAAACAATATGGG - Intronic
1065009444 10:21408260-21408282 ATTATCTGCAGAAACAGTGCAGG - Intergenic
1065555303 10:26909368-26909390 ATTTAATTTAGAAACGGTGAAGG - Intergenic
1065595551 10:27307438-27307460 ATTTAATTTAGAAACAGTGAAGG + Intergenic
1065807216 10:29405324-29405346 ATGTCCTTCTGTAAGAGTGAAGG + Intergenic
1065918475 10:30371131-30371153 ACTTCCATCAAAAACAGTTATGG + Intronic
1066384227 10:34928586-34928608 ATCACCTTCAGAAGCAGGGAAGG - Intergenic
1067103944 10:43352351-43352373 ATTTCTTTGAGAAAGAATGAAGG - Intergenic
1067443358 10:46325598-46325620 ATTTCCTTCAGAGACTGGAATGG - Intronic
1068617991 10:59141773-59141795 ATTCTCTTCAGAAACAATGGAGG + Intergenic
1072075631 10:91970253-91970275 ATTTACTTAACAAACATTGAGGG - Intronic
1072485380 10:95849673-95849695 ATTTCCCTCAGGAACCTTGAGGG - Intronic
1073765441 10:106677210-106677232 ATTTACTACAGAAACAGACACGG + Intronic
1074378116 10:112955290-112955312 ATCTCCTTCAGAAATATTTATGG + Intronic
1074833064 10:117263390-117263412 TCTTTCTCCAGAAACAGTGAAGG - Intronic
1075952147 10:126488985-126489007 ATCTCCTTCGGAAACAGAGGAGG + Intronic
1078171998 11:8935259-8935281 AATACCTTCAGAGAGAGTGAGGG + Intergenic
1078247268 11:9585374-9585396 ATTACCTTCAGATAAAGAGAAGG + Intronic
1079818347 11:25091973-25091995 ATTTCCTTCCAAAACACAGAGGG + Intergenic
1081527779 11:43938385-43938407 AATTCCTTCAGAAACATAGTAGG + Intronic
1081822424 11:46012450-46012472 ATTATCTCCACAAACAGTGAAGG + Intronic
1086574903 11:88328908-88328930 ACTTGCTTTAGAAACACTGATGG + Intronic
1087252031 11:95913146-95913168 ATTTTTTTCAGGAACAGTGATGG + Intronic
1088104394 11:106189638-106189660 ATGTCCTTATGAAAAAGTGAAGG - Intergenic
1088745311 11:112799824-112799846 ATTGCCATTAGAAACAGGGAGGG + Intergenic
1089265843 11:117260957-117260979 ATTTTCTACATAAACAGTCATGG + Intronic
1089283597 11:117391610-117391632 CTGTCCCTCAGAGACAGTGAGGG - Intronic
1089348399 11:117806923-117806945 ATTTGCTTCAGAAAAATTCATGG - Intronic
1091211925 11:133868951-133868973 CTTTCCATCAGAAACAATGAAGG - Intergenic
1092055921 12:5507905-5507927 TTTTCCTTCAGAGAAAGGGAGGG - Intronic
1095253604 12:40007209-40007231 TTTTCTATTAGAAACAGTGATGG + Intronic
1095253808 12:40009880-40009902 TTTTCTATTAGAAACAGTGATGG + Intronic
1098532522 12:71557083-71557105 ATCTCTTTAGGAAACAGTGATGG + Intronic
1099305979 12:80956339-80956361 CTTTCCTACTGAAACAGTGGTGG + Intronic
1100650085 12:96577127-96577149 AGTTACTTCAGAGCCAGTGATGG + Intronic
1100892633 12:99142835-99142857 GCTTCCTTTTGAAACAGTGAGGG + Intronic
1101444820 12:104730170-104730192 AGTTCCTCCAGAACGAGTGAAGG - Intronic
1102434583 12:112910984-112911006 ATTTCCTTCAGTCACTCTGAGGG - Intronic
1102874367 12:116438300-116438322 GTTGCCTTCAGAAACAGTTTGGG - Intergenic
1105636449 13:22220269-22220291 ATTACCATCAGATACAATGATGG + Intergenic
1107320879 13:39186706-39186728 ATTTCCAACAGAAACAGTAGAGG - Intergenic
1107708492 13:43130477-43130499 ATTTCTTTCAAAAAAAGCGATGG - Intergenic
1108561454 13:51648182-51648204 ATTTCCTAAAGAAATACTGACGG - Intronic
1109018830 13:57057882-57057904 ATTACCTTCAAAAACTGTCATGG + Intergenic
1110021636 13:70480392-70480414 ATTTACTTCAGAAATGGTGGAGG + Intergenic
1110179538 13:72598538-72598560 ATTTCCTCCAGCAATACTGAGGG - Intergenic
1110325427 13:74208835-74208857 ACTTCTTTAAGAAAGAGTGAAGG + Intergenic
1110942765 13:81370641-81370663 ATTTCCTGCAGAAACTATAATGG - Intergenic
1111342500 13:86905588-86905610 ATTTCTTTAAAAAATAGTGAGGG - Intergenic
1111413550 13:87910026-87910048 ATTTTGTTTAGAAACATTGAGGG + Intergenic
1114764499 14:25355785-25355807 AATTCCTTCAGAAGCAGTGATGG + Intergenic
1114895027 14:26977871-26977893 ATTTCTTTCTGAAACAGTGTAGG + Intergenic
1116644127 14:47504597-47504619 ATTTCCCTCAGGATCAGTAATGG - Intronic
1117201532 14:53394737-53394759 TTTTTCTTCAGTAACAATGATGG + Intergenic
1117434605 14:55703927-55703949 ACTTCCTTCAGAAAGACTCAGGG - Intergenic
1118014119 14:61640910-61640932 CTTTTCTTCAGCAACAGAGAAGG - Intronic
1118696247 14:68388475-68388497 ATTTAGTTGAGAAACACTGAAGG + Intronic
1119058283 14:71446768-71446790 TTCTCCTTCTGAAACAGTAAGGG + Intronic
1120209626 14:81622220-81622242 ATTTCCATGAGAAACTGTGCAGG + Intergenic
1120547257 14:85827220-85827242 ATTTGTTTCAGAAACCATGAGGG + Intergenic
1121167444 14:91819086-91819108 ACATCATTCAAAAACAGTGATGG + Intronic
1122057030 14:99106560-99106582 ATTTCCTTCATGAATAATGAGGG - Intergenic
1124002222 15:25768998-25769020 ATTTCCCTTAGAAATAGTGAGGG - Intronic
1124013546 15:25858786-25858808 ATTTCCTGCAGAAATACTGCTGG + Intronic
1124090870 15:26598897-26598919 GTTGCCTTCAGAAACAGAGTGGG + Intronic
1126438817 15:48664976-48664998 ATACCATTCAGAAACACTGATGG - Intergenic
1127443300 15:59034086-59034108 ATCTCCTTCAGAAAATGTGAAGG + Intronic
1129148668 15:73672836-73672858 GTTTCCTTCAAAAGCAGTGGGGG - Intergenic
1129653367 15:77506958-77506980 ATTTCATCCAGAAACAGGCATGG - Intergenic
1129855861 15:78824625-78824647 ATTTCCTTGTGACACAGAGAAGG - Intronic
1132869100 16:2107758-2107780 ATTTGCATCAGAAACAGAGAGGG + Intronic
1133608687 16:7413108-7413130 TTTTACTTGAGAAGCAGTGATGG + Intronic
1134550154 16:15135155-15135177 ATTTGCATCAGAAACAGAGAGGG + Intronic
1134718315 16:16367840-16367862 ATTTGCATCAGAAACAGAGAGGG - Intergenic
1134956437 16:18384319-18384341 ATTTGCATCAGAAACAGAGAGGG + Intergenic
1135473513 16:22753197-22753219 AATTCCTCCAAAGACAGTGATGG - Intergenic
1135586293 16:23674035-23674057 CTTTTCTTCAGCAGCAGTGAAGG - Exonic
1135625699 16:23993003-23993025 ATTGCCCTAAGAAACAGTAATGG + Intronic
1136637049 16:31530899-31530921 TTTTCCTTCAGGAACAGTAATGG - Intergenic
1137480155 16:48845755-48845777 CTTTCTTTCAGCATCAGTGATGG - Intergenic
1138475295 16:57267162-57267184 ACTTCCCTCAGAGTCAGTGAAGG - Intronic
1139898600 16:70308994-70309016 TTATCCTTCAGAATTAGTGAAGG + Intronic
1140015960 16:71184962-71184984 ATTTCCTTCAGGAACTCTGAGGG + Exonic
1140789667 16:78379387-78379409 ATTTCCTCCAGATACAATGGAGG + Intronic
1141519134 16:84566082-84566104 ATTTCCTTGTGACACAGAGAAGG - Exonic
1143168551 17:4911989-4912011 CTTGCCTTCAGAAAGAGAGAAGG + Intergenic
1144735101 17:17551154-17551176 ATTTCCTTCATCAACAGTCGAGG - Intronic
1145194705 17:20881394-20881416 ATTTTTTTCAGAAAGGGTGAAGG + Intronic
1145211908 17:21020112-21020134 GTTTCCTTTGCAAACAGTGATGG + Intronic
1145874371 17:28305705-28305727 AGTTCCATTAGAAACAGTTAAGG - Intergenic
1146261930 17:31427641-31427663 ACTTGCTTCAGAAATAATGAAGG + Intronic
1147694690 17:42342517-42342539 ATTTCCTACAGTAATGGTGAGGG + Intronic
1149109944 17:53017021-53017043 ACTTTCTTCAGAAACAGTAAAGG + Intergenic
1149158356 17:53661392-53661414 ATTGCCTTCTGAAATAGTGGTGG - Intergenic
1150296521 17:64011511-64011533 ATTTCCTTAATAATTAGTGATGG - Intronic
1150460949 17:65350839-65350861 TTTTCCTTTTGAGACAGTGAGGG - Intergenic
1151652563 17:75479110-75479132 ACTTCCTTCAGAAAGTATGAAGG + Intronic
1152287028 17:79418763-79418785 AATTCCTTCCCAAAAAGTGAGGG + Intronic
1152621021 17:81364901-81364923 AGTTCCTTCATATCCAGTGAAGG + Intergenic
1153744906 18:8167745-8167767 CCTTCCTTCAGAAACAGACACGG + Intronic
1155446704 18:25920720-25920742 TTCTCCATCAGCAACAGTGAGGG + Intergenic
1156584995 18:38422146-38422168 ATTTCACTCTGAAACAATGAAGG + Intergenic
1156990622 18:43403218-43403240 ACTGCCTTAAGCAACAGTGATGG - Intergenic
1157340644 18:46774799-46774821 ATGTCCTTAAGAAACAGAAAAGG - Intergenic
1157434516 18:47657252-47657274 ATATCCTTCAAAAACAAAGATGG + Intergenic
1158036346 18:53035826-53035848 TTCTCCTTTAGAAACAGTAATGG + Intronic
1158352383 18:56575915-56575937 CTTTCCTTTTGAAACAGTAATGG - Intergenic
1159231560 18:65613647-65613669 ATTTACCTCAGAAAGGGTGAAGG - Intergenic
1159509210 18:69374942-69374964 ATTTCCTTGATAAAAATTGAGGG + Intergenic
1160142203 18:76335714-76335736 ATTACATTCAGAAACAGAGAGGG - Intergenic
1160302293 18:77693828-77693850 ACATCCTTCAGAAAAAGTGGGGG - Intergenic
1160303832 18:77712706-77712728 CTTCCTGTCAGAAACAGTGAAGG + Intergenic
1161564075 19:4989983-4990005 ATTTCCTTTAGAAACAGTTTGGG + Intronic
1162156988 19:8684899-8684921 ATTTCCTCCGGAAACAGGGGAGG + Intergenic
1163096688 19:15063225-15063247 AGTGACTTCAGAAACACTGAAGG - Intergenic
926246599 2:11126195-11126217 CATTCCTTCTGAGACAGTGAGGG - Intergenic
926406601 2:12559407-12559429 ATTTCCTTTAGAAACATTCTGGG - Intergenic
926751997 2:16205225-16205247 ATTTCCTCCAGAACCAGTGTAGG + Intergenic
927635012 2:24807865-24807887 ATTTGCTTCATAACCAGTGATGG + Intronic
928256714 2:29729145-29729167 ATTACCTTCTGGAAAAGTGAAGG + Intronic
929303620 2:40334177-40334199 ATTTACTTCAGAAACAAGGCAGG - Intronic
929359325 2:41065455-41065477 TTTGCCTTAAGAAGCAGTGAGGG + Intergenic
929624288 2:43390407-43390429 ATTTTCTTCTGAAACTGTGCTGG - Intronic
931092216 2:58898409-58898431 ATGTTCTTCAGAAACAATAAAGG - Intergenic
931997252 2:67850899-67850921 ATGTCTTTCAGCATCAGTGATGG - Intergenic
933650830 2:84848943-84848965 ATTTCCTTCAGAAACAGTGAAGG - Intronic
935833700 2:107026663-107026685 ATTTCATTCAGGCAAAGTGAAGG + Intergenic
936594129 2:113831574-113831596 GTTTCTTTCAGAAAGAGCGAGGG - Intergenic
939232637 2:139449703-139449725 TTTTCCTCTGGAAACAGTGATGG + Intergenic
940060472 2:149559957-149559979 AATTTCTTCAGAAACAATAATGG - Intergenic
940752674 2:157644725-157644747 AATTACATCAGAAACAATGAAGG + Intergenic
941023676 2:160437504-160437526 CTTTCCATCAGTAACAGTGAAGG + Intronic
941174891 2:162184584-162184606 GTGTCCTTCAGAATCAGTGTCGG - Intronic
942508170 2:176665849-176665871 ATGTACTAGAGAAACAGTGAAGG + Intergenic
944268646 2:197756441-197756463 GTTTCCATCAGAGACAGTGGAGG + Exonic
944313228 2:198258568-198258590 ATTTCCATCAGAAACAGAAACGG - Intronic
944853658 2:203745341-203745363 ATTTTCTCCAGAAAAAGTGATGG - Intergenic
945431196 2:209767850-209767872 ATGTCCTACATAAACTGTGAAGG - Intergenic
945918184 2:215726736-215726758 ATTTTGTTGAGAAACAATGATGG + Intergenic
946470376 2:219954323-219954345 ATTTGCTTAAGAAAAAATGAGGG - Intergenic
947898083 2:233693960-233693982 ATTTCCTGGAGAAACGGTGGGGG + Intronic
1168885051 20:1244205-1244227 ATTTTCTACAGATACAGTAAAGG + Intronic
1169593646 20:7173697-7173719 AATTCATTCTGAAAGAGTGAAGG - Intergenic
1169835791 20:9876729-9876751 ATTTTCATCAGAAACAATGGAGG + Intergenic
1170336495 20:15275872-15275894 GTTTCCTTCAGTGATAGTGAAGG - Intronic
1170445252 20:16420098-16420120 AGTTCTTCCAGAAATAGTGATGG - Intronic
1171329258 20:24323126-24323148 ATTTTCCTTTGAAACAGTGATGG + Intergenic
1171430157 20:25077976-25077998 ATTTCCTTCAGAAATAGCATGGG - Intronic
1172832712 20:37849659-37849681 ATTTTCTGCAGAAACTGTCAGGG - Intronic
1172853077 20:37980785-37980807 ATTTCCTTTGGAAAAAGGGAGGG - Intergenic
1177472655 21:21579119-21579141 TTTTCCTTCAGCAACTGTCAAGG + Intergenic
1179033552 21:37741015-37741037 CTTTCCCCAAGAAACAGTGAGGG - Intronic
1179041162 21:37803289-37803311 CCTTCCTTCAGAGACAGTGCTGG + Intronic
1179074790 21:38109921-38109943 TCTTCCTTGAGAAACAGGGAAGG + Intronic
1182274213 22:29175097-29175119 CTTGTCATCAGAAACAGTGAAGG - Intergenic
1182728896 22:32471699-32471721 ATTTCCTCCCGAAAAAGGGAAGG - Intergenic
1182954905 22:34414882-34414904 ATGTCCTTCAGGTACAGTGTAGG + Intergenic
1183459602 22:37941834-37941856 ATTTCCTGCAGAAAAGGTGGCGG - Exonic
1183765086 22:39865898-39865920 ATTTCCTAGAGAAGCAGAGATGG - Intronic
1183823273 22:40364460-40364482 ATTACCTTCAGTCACAGTAATGG + Intronic
1185240926 22:49746219-49746241 CTTTTCATCAGAAACAATGAAGG - Intergenic
949560793 3:5200343-5200365 ATTTCCTTCAGAAATATGTAGGG - Intronic
951629331 3:24702004-24702026 CTTTCCATCAGAAACAATTAAGG - Intergenic
952538548 3:34340332-34340354 ATTTCCCTTAGCAACACTGAAGG - Intergenic
953890382 3:46747840-46747862 ATTTTTTTCAGAATCAGTGGAGG - Intronic
954861098 3:53691092-53691114 GTTTCGTTCAGAGAGAGTGATGG + Intronic
956536007 3:70277722-70277744 ATTCACTTAAGAAACAGGGAGGG + Intergenic
957172580 3:76757674-76757696 ATTTGTTTCTGAAACAGTGGGGG + Intronic
958150519 3:89687634-89687656 TTTTTCTTGAGAAACATTGATGG + Intergenic
959143723 3:102518166-102518188 ATATCCTTCAGAAACAATAATGG - Intergenic
963398559 3:144766181-144766203 ATGTCCTTTAGAAAAAGTGAGGG - Intergenic
965631552 3:170738565-170738587 CATTCCTTCAGCCACAGTGAGGG + Intronic
966568347 3:181409047-181409069 ATCTGCTGCAGAAACAGGGAAGG - Intergenic
967114975 3:186328893-186328915 ATTTCCTTCAAGAAAAGTTAGGG + Intronic
968477546 4:819342-819364 CTTTCCTCCCGAAACCGTGAAGG - Intronic
969762272 4:9196970-9196992 ATATCCTTCAAATAAAGTGACGG - Intergenic
970086386 4:12351962-12351984 ATGTCCTTAAGAAAAAGTGCAGG + Intergenic
970229640 4:13896339-13896361 ATTACCTTGAGAAAGAGTGAAGG - Intergenic
970462515 4:16289355-16289377 GTTTACATCAGAAATAGTGAGGG + Intergenic
970529596 4:16968432-16968454 ATTTCCTTCTGAAAATATGATGG - Intergenic
971020588 4:22531197-22531219 ATTGCCTTCAGAAACACCAAAGG + Intergenic
972278881 4:37584588-37584610 ATTTCCTTCAGAAGCAGGGAAGG + Intronic
973020203 4:45195350-45195372 ATTTTCTTTATAAATAGTGATGG - Intergenic
974250465 4:59377557-59377579 ATTCCTATCAGAAACAGTGCTGG + Intergenic
975525561 4:75345482-75345504 ATTTCCTTCAGCAAGAGAGTTGG - Intergenic
975840280 4:78466377-78466399 TGTCCCATCAGAAACAGTGAAGG - Intronic
976786196 4:88824264-88824286 ATGACATTCAGAAACAGTGAGGG + Intronic
977196272 4:94064611-94064633 ATTTCTTCCAGCAACAATGAAGG - Intergenic
978211486 4:106142772-106142794 ATTTTCTTCATGAAGAGTGATGG - Intronic
978419510 4:108515304-108515326 ATTTTCTATAGCAACAGTGAAGG + Intergenic
978487768 4:109275671-109275693 ATTTCTTGGAGAAAGAGTGAAGG - Intronic
981142593 4:141286841-141286863 ATTTTTTTAAGAAACAATGATGG - Intergenic
982302435 4:153893255-153893277 ATTGCTCTCAGAAACATTGAAGG + Intergenic
982378018 4:154715973-154715995 ATTTCCTTCTGTAAGAGTGGAGG - Intronic
982558183 4:156895655-156895677 ATTACTTTCAGAAACTCTGATGG - Intronic
982686097 4:158490724-158490746 TGTTCCTTCAGTAACAGTCAAGG + Intronic
983338593 4:166428018-166428040 ATTTCCTTCAGTATCTGTGTGGG + Intergenic
983514598 4:168642732-168642754 ATTTGCTTCTGAAAAAGTGCAGG - Intronic
984183965 4:176519867-176519889 ACTTCCTTCTGAAAAAGAGAAGG - Intergenic
984208557 4:176817100-176817122 ACTTCCTTAAGAAACAGTATAGG - Intergenic
985221801 4:187714050-187714072 ATCCCCTTCAAAAATAGTGACGG + Intergenic
985346367 4:189009366-189009388 ATTTCCTTGACAATTAGTGATGG + Intergenic
986767430 5:10940406-10940428 ATTTGTATCACAAACAGTGATGG + Intergenic
987744454 5:21951843-21951865 ATTTCCTTAAGCAAGAGTGAGGG + Intronic
988096218 5:26614066-26614088 ATTTCCTTAAGAATAAGTTAGGG + Intergenic
988151468 5:27387443-27387465 TTTAATTTCAGAAACAGTGAAGG + Intergenic
990126909 5:52530426-52530448 ATTTCCTTCAGACAGAAGGATGG + Intergenic
990289111 5:54330825-54330847 ATTTCATCCAGAAAAAGGGATGG - Intergenic
990297616 5:54419017-54419039 ATTTGCTTCAGATACAATCATGG - Intergenic
990528747 5:56653649-56653671 GTTTCCTGTAGAAACAGAGAAGG - Intergenic
991577416 5:68119610-68119632 ATTTCATTCAGAAATAGGGATGG - Intergenic
991589263 5:68232041-68232063 ATTTCCTACTGAAACACAGAGGG - Intronic
991764664 5:69961967-69961989 ATTTCCTTAAGGAAGAGTGAGGG + Intergenic
991782660 5:70156186-70156208 ATTTCCTTAAGGAAGAGTGAGGG - Intergenic
991843896 5:70837038-70837060 ATTTCCTTAAGGAAGAGTGAGGG + Intergenic
991875103 5:71156500-71156522 ATTTCCTTAAGGAAGAGTGAGGG - Intergenic
992007728 5:72494988-72495010 ATTTCCTCCTGAAAATGTGAAGG - Intronic
992644993 5:78803610-78803632 AGTTCCCACAGAAACAGTGCTGG + Intronic
992888516 5:81182737-81182759 ATTTCATTCAGAAGATGTGAAGG + Intronic
993897030 5:93548107-93548129 ATTTCCTTCAGGAAAACTGAAGG - Intergenic
993947043 5:94127813-94127835 CTTTTCATCAGAAACAGTGAAGG + Intergenic
994338162 5:98593772-98593794 ATTTCCTTCAGTTATTGTGAGGG - Intergenic
994807707 5:104472974-104472996 TTTACCTTCAGAAACAATGGAGG - Intergenic
996317193 5:122173453-122173475 ATTTCAATCAGTAACAATGAAGG + Intronic
999450699 5:151675727-151675749 GTTGGCTTCTGAAACAGTGAGGG - Intronic
1000137429 5:158366237-158366259 ACTTTCTTCAGAAGCTGTGAAGG + Intergenic
1000170360 5:158696486-158696508 CATTCCTTCAGAAACAGTTAAGG + Exonic
1003494881 6:6655038-6655060 ATTTCCTCCAGATACAGTGCCGG + Intergenic
1003534020 6:6960431-6960453 ATTTGCTTCAGAAATAATCAAGG + Intergenic
1003833013 6:10035782-10035804 CTTTTCTTCAAAAGCAGTGAAGG + Intronic
1004853134 6:19721184-19721206 ATTTGCTTTGGAAACAATGATGG - Intergenic
1005199916 6:23333147-23333169 GTATCTTTCAGAAACAGTGTGGG + Intergenic
1006972147 6:38057150-38057172 ATCTGATTCAGACACAGTGAAGG - Intronic
1007060433 6:38935237-38935259 ATTTCTTACAGAAGCAGTGTGGG + Intronic
1008341822 6:50375288-50375310 CTTTTCATCAGAAACAATGAAGG - Intergenic
1008526189 6:52409460-52409482 TTTTCCTTCAGAAAAATTCACGG + Intergenic
1008768091 6:54944228-54944250 ATTTCATCCACAAACTGTGATGG - Intergenic
1009441222 6:63681112-63681134 TTTTCCTTCAGAAATTCTGAAGG + Intronic
1010152384 6:72748920-72748942 GTTTCATTCAGAAAAAGTAAAGG + Intronic
1011338992 6:86291773-86291795 AATTCATGTAGAAACAGTGAAGG - Intergenic
1011968218 6:93187481-93187503 ATTTTCTTTAGAAATAGGGAAGG - Intergenic
1012593045 6:101006086-101006108 TTTTCCTTCAGAAATTGTTATGG + Intergenic
1012693197 6:102342785-102342807 ATATCCTTTAAAAAAAGTGAAGG - Intergenic
1013235966 6:108198159-108198181 ACTTCTTTCAGAAAGAGAGAGGG + Intergenic
1013274957 6:108575422-108575444 ATTTTCTTCTGATACTGTGATGG + Intronic
1013864401 6:114677646-114677668 TTTTCATTCAAAAACAGGGAAGG + Intergenic
1014005530 6:116413505-116413527 ATTTCATTAAGAAACAGTACAGG + Intronic
1014136758 6:117898266-117898288 CTTTCCTCCAGATACAATGAGGG - Intergenic
1015326881 6:131933534-131933556 ATTGCCGTCAAAAATAGTGAGGG + Intergenic
1016503972 6:144756114-144756136 ATTTACTTCATCAACATTGATGG - Intronic
1017166695 6:151414842-151414864 ATTTCCGTCAGAAACCATGGAGG + Intronic
1017509504 6:155101339-155101361 TTTTTCATCAGAAACAGTGTGGG + Intronic
1017546303 6:155454503-155454525 CTTTCAGTCAGAAACAATGATGG + Intronic
1017803479 6:157921767-157921789 ACTTCCTCCAGTGACAGTGAGGG + Intronic
1019140358 6:169938703-169938725 ATCACCTTCAGAAGCAGAGAAGG + Intergenic
1020800977 7:12731665-12731687 ATTTCCTTTAGAAACAAGTATGG - Intergenic
1020842187 7:13232409-13232431 ATTTCCTTTAGAAACTGGGGAGG + Intergenic
1020936212 7:14466986-14467008 ATGTCCTCCAGAAACTCTGATGG - Intronic
1021228789 7:18060498-18060520 TTTTCCTTCAGACCCAGTTATGG - Intergenic
1021813585 7:24426471-24426493 ATTACATTCTGGAACAGTGAGGG - Intergenic
1023240089 7:38135019-38135041 ATTTCCATCAGAAACCATGGAGG + Intergenic
1028150349 7:87365080-87365102 TTTTTCTTCAGCATCAGTGAGGG + Intronic
1028187657 7:87806800-87806822 ACTTCCATCAAAAACAGTCATGG + Intronic
1028957463 7:96709812-96709834 GTTTCCTTGAGGAAGAGTGAGGG - Exonic
1030197128 7:106863563-106863585 AGTTCCTTCAGAAGCAGGCAGGG + Intergenic
1030281080 7:107776108-107776130 ATCAACTTCAGAAACAATGAAGG - Intronic
1030566881 7:111168724-111168746 ATTTCCTACAGAAAGAATGTAGG - Intronic
1030655921 7:112167754-112167776 TTTTCCTTAAGAAACAATCAAGG - Intronic
1030848205 7:114448848-114448870 ACTTCTTTCAGAAACAGAGCAGG + Intronic
1032627015 7:133602342-133602364 AATTCTTTCAAAAACAGTCAGGG - Intronic
1033874844 7:145803145-145803167 ACTTCCTTCAAAAACATTGCTGG + Intergenic
1034405630 7:150900834-150900856 ATTCCCTACAGCAACAGTGAGGG - Intergenic
1036844253 8:12152094-12152116 ATATCCTTCAAATAAAGTGACGG + Intergenic
1036865625 8:12394416-12394438 ATATCCTTCAAATAAAGTGACGG + Intergenic
1038682287 8:29679812-29679834 ATTCCCTTCTTCAACAGTGAAGG - Intergenic
1039216641 8:35279251-35279273 TTTTCTTTCAGAAACACCGAAGG - Intronic
1040602787 8:48900463-48900485 TCTTCCTTCACACACAGTGAAGG - Intergenic
1040676446 8:49756649-49756671 ATTTCATGCAGAAGCAGTGACGG - Intergenic
1041474300 8:58246845-58246867 CTTCCCAACAGAAACAGTGATGG + Intergenic
1042295738 8:67215569-67215591 ATTTAATTCACACACAGTGAGGG + Intronic
1043329106 8:79091568-79091590 ATTTCTTTTAGAAAAATTGATGG + Intergenic
1043864594 8:85360775-85360797 TCTTCCTTAAGAAACAGGGATGG - Intronic
1043966497 8:86483274-86483296 ATTTTTTTAAAAAACAGTGAAGG - Intronic
1044304201 8:90618753-90618775 CTTTCCTTCATAAACAGTTAAGG - Intergenic
1044703333 8:94984528-94984550 ATTTCCTTCTGAAACTCAGAGGG + Intronic
1046853266 8:119000073-119000095 ATTTCCTAAAGCAGCAGTGAAGG + Intronic
1047163004 8:122402578-122402600 ATTTCCTTAATAATTAGTGAAGG - Intergenic
1047212008 8:122847860-122847882 CTTCCCTTCAGAAACAGTTGAGG + Intronic
1047666606 8:127098401-127098423 ATTTCCTTCACACACAGGGCTGG + Intergenic
1047887048 8:129262995-129263017 ATCTCCTTCAGATACTGTTAGGG - Intergenic
1048114253 8:131503834-131503856 ACTTCCATCAGAAACAATGGAGG + Intergenic
1048482034 8:134806387-134806409 TTTTTCTTCAAAAACAGTGAAGG - Intergenic
1048648893 8:136452810-136452832 ATTTCCTACAGAAGGAGAGAAGG - Intergenic
1049704088 8:144031351-144031373 ATTTTCATCAGAAACTATGAAGG - Intronic
1049854916 8:144855414-144855436 CTTTCCTTCAGAGACATTGCAGG - Intergenic
1049968168 9:797945-797967 ATTTCCTCTAGAAACTGCGATGG - Intergenic
1050190490 9:3020030-3020052 ATTCCTTTTAGAAACAGTGTGGG - Intergenic
1050982178 9:12034670-12034692 ATCTTCTCCAAAAACAGTGATGG + Intergenic
1051138361 9:13950260-13950282 ATTTCCCTCAGAAACAGGGTGGG + Intergenic
1051174328 9:14347716-14347738 ATTTCCTTAGGAAACAGACAAGG + Intronic
1051677729 9:19575002-19575024 ATTTTCTTAAGCACCAGTGATGG - Intronic
1051772952 9:20599398-20599420 TTTTCCTTCAGAAATTCTGAAGG - Intronic
1051815007 9:21094980-21095002 CTTTCCTCCAGAAGCAGGGAAGG - Intergenic
1051817053 9:21120822-21120844 CTTTCCTCCAGAAGCAGGGAAGG + Intergenic
1052861281 9:33439371-33439393 TTTTCCTGCAGAACCAGAGATGG - Intergenic
1052957402 9:34264029-34264051 ACTCCCATCAGAAACAGTGGTGG + Intronic
1055002766 9:71471658-71471680 TTTCTCATCAGAAACAGTGAAGG - Intergenic
1055008369 9:71535585-71535607 ATTTCAGTAAGAAATAGTGAAGG - Intergenic
1056024367 9:82477547-82477569 ATTTCCATCAGGAATGGTGAAGG - Intergenic
1056247980 9:84717366-84717388 TTTTCCTTAAGAGAAAGTGAGGG + Intronic
1057005916 9:91558974-91558996 ATTCCCATCAGAAACAGAGGAGG + Intergenic
1057396767 9:94687723-94687745 CTTTCCTTCACAAACACTGGAGG - Intergenic
1057822945 9:98347314-98347336 ATTTCCTTGATAATTAGTGATGG + Intronic
1058769154 9:108213596-108213618 ATTTGCTTTAGAAGCAGTAAAGG + Intergenic
1060115659 9:120938068-120938090 AATCCCTTAAGAAACAGTGTTGG + Intergenic
1060454933 9:123783320-123783342 ATTTTGTTCTGAAACAGTGTGGG + Intronic
1060623866 9:125092637-125092659 ATGTCCTTGAATAACAGTGAGGG - Intronic
1185534545 X:850343-850365 CTTTCCTTCAGACACAGTCTGGG - Intergenic
1186744995 X:12558279-12558301 TTTCCCTTGAGAAACAATGAGGG + Intronic
1188286144 X:28327609-28327631 CTTTCCTCCAGATACAGGGAAGG + Intergenic
1188989436 X:36799894-36799916 TTTTCCATCAGGAACAGTCAGGG + Intergenic
1189392288 X:40586316-40586338 GCTTCCTTAACAAACAGTGAAGG + Intronic
1189438085 X:41010388-41010410 TTTCCCGTCAGATACAGTGAAGG + Intergenic
1189825998 X:44918077-44918099 ATTTCTTCCAGAAACTGTGTTGG + Intronic
1189981732 X:46517637-46517659 ATTCTCATCAGAAACAGTGGAGG + Intronic
1194068492 X:89291236-89291258 ATTTCATTCAGATATAGTGCAGG - Intergenic
1194138757 X:90181096-90181118 ATTTCCATAAAAAAAAGTGATGG + Intergenic
1194933076 X:99912907-99912929 TTTTCTTTCAGAAACAGTGCAGG + Intergenic
1195951616 X:110280870-110280892 ATTTCCTTGATAAACTGTGAGGG + Intronic
1196212988 X:113016093-113016115 ATATCTTTCAGAAACAATAAAGG - Intergenic
1196564595 X:117189811-117189833 ATTTCCCTGAGAAAAAGTAAAGG + Intergenic
1196679541 X:118456569-118456591 ATTGCTTTCAGTAACATTGAAGG + Intergenic
1198031532 X:132757912-132757934 CTTTCCTTCAGGAACAGAAAGGG + Intronic
1198065442 X:133091901-133091923 ATCTCCTTCAGAACCTGTGATGG - Intronic
1198443568 X:136688899-136688921 CTTCCCTTCATAAACAGTTATGG - Intronic
1200382650 X:155855405-155855427 ATTTCCTTAAGAGACAAAGAAGG - Intergenic
1200722635 Y:6625395-6625417 ATTTCATTCAGATATAGTGCAGG - Intergenic
1201986511 Y:19974603-19974625 GTTTCCTTCGGAAACAGTGTGGG + Intergenic
1202100125 Y:21298912-21298934 ACTTCCTGAGGAAACAGTGATGG + Intergenic