ID: 933652156

View in Genome Browser
Species Human (GRCh38)
Location 2:84858263-84858285
Sequence CTGGTGGGAGACGATGTTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 255
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 235}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933652156_933652165 25 Left 933652156 2:84858263-84858285 CCTCCAACATCGTCTCCCACCAG 0: 1
1: 0
2: 1
3: 18
4: 235
Right 933652165 2:84858311-84858333 CAACCCAGCCTGCCACCCTGTGG 0: 1
1: 0
2: 2
3: 29
4: 286

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933652156 Original CRISPR CTGGTGGGAGACGATGTTGG AGG (reversed) Intronic
900183674 1:1323322-1323344 CTGGAGGGACATGGTGTTGGTGG - Intronic
900973584 1:6004836-6004858 CTGGAGGGAGACGGGGCTGGAGG - Intronic
902856478 1:19210034-19210056 CTGGCGGGCGACGCTGTTGTGGG - Intronic
903702054 1:25256563-25256585 CTGGTGGGAGCTGAGGTAGGAGG - Intronic
904304598 1:29580106-29580128 CTGGTGGGAGTCTAAATTGGAGG - Intergenic
905641093 1:39590502-39590524 CTGGTGGGAGGTGATATTGAAGG - Intergenic
905733442 1:40311480-40311502 CTGGTGAGAGACGAGGTCTGGGG - Exonic
906492305 1:46278227-46278249 CTGGTGGAAGACGAAGGTGATGG - Exonic
906539047 1:46570756-46570778 CTGGTGGGAGGTGAGGATGGAGG + Intronic
906821447 1:48934590-48934612 CTGGAGGAAGAGCATGTTGGGGG - Intronic
907660389 1:56387056-56387078 CTGGAGGCAGACCAGGTTGGGGG - Intergenic
908290583 1:62662863-62662885 GAGTTGGGAGAGGATGTTGGGGG - Intronic
908779849 1:67680356-67680378 TAGGTGGGAGATGATGCTGGTGG + Intergenic
911184289 1:94887804-94887826 CTGCTGTAAGACGATGCTGGGGG + Intronic
912963516 1:114216841-114216863 CTGGTGGGAGGAGGTGTAGGGGG - Intergenic
915400050 1:155615596-155615618 CTGCTGGGAGATGATGCTGAAGG + Intergenic
915417256 1:155751791-155751813 CTGCTGGGAGATGATGTTGAAGG + Exonic
916883733 1:169047254-169047276 CTGGTGGGAGGAGAAGTAGGAGG - Intergenic
919673303 1:200357424-200357446 CTGGTGGGGGAGGAGGTTGGGGG + Intergenic
922073724 1:222221503-222221525 CTGGTTGGAGATGTTGTTTGTGG + Intergenic
923525401 1:234768718-234768740 CTGGTGGGTGAGTCTGTTGGGGG + Intergenic
924043761 1:240008597-240008619 CAGGTGGGAACAGATGTTGGAGG + Intergenic
1064683457 10:17834883-17834905 CTGGAGGGAGGAGATTTTGGGGG - Intronic
1067759101 10:49029904-49029926 CTGGTGGGAGAGGGTGATGGAGG + Intronic
1067913416 10:50370823-50370845 CTGGTGGGACAAGATGTGGAAGG - Intronic
1068658622 10:59600615-59600637 GTGGGGAGAGACAATGTTGGTGG + Intergenic
1068765242 10:60756173-60756195 TTGGTGGGGGAAGATATTGGAGG + Intergenic
1069941874 10:71962179-71962201 GTGGTGGGAGACGGGGGTGGTGG + Intergenic
1070159565 10:73858001-73858023 CTAGTGGGAGATGTTGATGGTGG - Intronic
1070493447 10:76999060-76999082 CTGGTGGGGGCTGATTTTGGAGG + Intronic
1074554419 10:114475152-114475174 CAGGTGAGAGACGAGGTAGGAGG - Intronic
1076699593 10:132264575-132264597 CTGGTGGGAGAGGGTCCTGGAGG - Intronic
1077347504 11:2070667-2070689 CTAGTGGGACAGGATGGTGGAGG - Intergenic
1077417012 11:2428776-2428798 GTGGTGGGTGACGAAGGTGGTGG + Intergenic
1077520829 11:3032951-3032973 CTGGTGGGTGCGGATGCTGGGGG + Intronic
1077900809 11:6486815-6486837 CTGGTGGGAGATTATGGTGAAGG - Intronic
1078361791 11:10674952-10674974 CTCTTTGGAGAAGATGTTGGGGG + Intronic
1078401294 11:11029555-11029577 CTGGTGGAAAAAGATTTTGGGGG + Intergenic
1078890918 11:15558208-15558230 CTGGTGGGAGATGTTGGTAGTGG + Intergenic
1081051658 11:38349470-38349492 CTAGTGGGAGATGATCATGGGGG - Intergenic
1084190824 11:67497996-67498018 CTGATTGGAGATGGTGTTGGTGG - Exonic
1085143574 11:74171618-74171640 CTGATAGGAGAAAATGTTGGCGG + Intronic
1085531060 11:77192214-77192236 CTGCTGGTAGATGAGGTTGGTGG - Exonic
1087382218 11:97420841-97420863 CTGGTGTGGGATGATGATGGTGG - Intergenic
1087818580 11:102686287-102686309 CTGTGGGGAGACGATTTTGGAGG + Intergenic
1087847595 11:102990948-102990970 CTGTGGGGAGAAGATGGTGGAGG + Intergenic
1090099440 11:123778615-123778637 TTGGTGGGAGAGGATGTTCTGGG + Intergenic
1094201378 12:27797907-27797929 CTGGCGGGTGACGGTGTTGTAGG - Exonic
1096213020 12:49780822-49780844 ATGGCAGGAGAAGATGTTGGAGG - Intergenic
1097644503 12:62220646-62220668 CTGGTGGGAGATGTTGATAGTGG + Intronic
1100205427 12:92343624-92343646 CTGGTGGGAGATGTTGATGATGG - Intergenic
1103702383 12:122854734-122854756 CCTGTGGGAGACGCTGTGGGAGG - Intronic
1104610133 12:130220853-130220875 CTGGTGGGCGATGCTGATGGCGG - Intergenic
1104728582 12:131092944-131092966 CTGGCTGGAAACGATGCTGGAGG + Intronic
1105427341 13:20305646-20305668 CTGGTGTGACAAGATGTTGAGGG - Intergenic
1105471957 13:20703293-20703315 TTCGGGGGAGAAGATGTTGGGGG + Intronic
1106285408 13:28314184-28314206 CTGTGGGGAGACGATGGTGCAGG - Intronic
1106405287 13:29468008-29468030 GTGGTGGGAGATGAGGTGGGAGG + Intronic
1107160276 13:37217648-37217670 CTGGTGGGGGATGATGATGATGG - Intergenic
1108715079 13:53070985-53071007 CTGGAGAGATACGATGATGGTGG + Intergenic
1110733872 13:78911924-78911946 GTGGTGGGAGATGAGGTCGGGGG - Intergenic
1112030607 13:95453336-95453358 CTGGTGGGTGAGGTTGTTGGTGG - Intronic
1112317321 13:98374864-98374886 ATGGTGGGAGAGGAGGTGGGTGG + Intronic
1113261045 13:108563472-108563494 GTGGTGGGAGAGTGTGTTGGGGG - Intergenic
1113861028 13:113487249-113487271 CTGGTGGTGGACCATTTTGGGGG - Intronic
1119027326 14:71164435-71164457 CTGGTGGGAGGCGGGGTGGGGGG + Intergenic
1119401195 14:74363838-74363860 CTGGAGGAAGAGGATTTTGGTGG + Intergenic
1119754568 14:77106314-77106336 CTGGGGGGAGGGGTTGTTGGAGG - Intronic
1123012934 14:105357953-105357975 GTGGTGGGAGAGGATGTGGGGGG + Intronic
1124639693 15:31389876-31389898 GTGGTTGGAGACGGTGGTGGTGG - Intronic
1127679214 15:61276211-61276233 GGGGTGGGAGAGGATGTTTGAGG + Intergenic
1128747914 15:70127464-70127486 CCAGTGTGAGACGATGTGGGTGG + Intergenic
1129265175 15:74389482-74389504 CAGGAGGGAGACGAAGCTGGAGG + Intergenic
1129393147 15:75230640-75230662 CTGGGGGAAGAGGATGTTGAGGG - Intergenic
1129673206 15:77618309-77618331 CTGGTGGGAAAAGAGGTGGGTGG - Intronic
1130682213 15:86006634-86006656 GCAGTGGGAGATGATGTTGGAGG + Intergenic
1131328388 15:91470774-91470796 CAGGTGAGAGATGATGGTGGTGG - Intergenic
1133180335 16:4049403-4049425 CTGGTCTGAGAACATGTTGGGGG - Intronic
1134219914 16:12345807-12345829 CTGGTGGGAGAGGAGGTGGGAGG - Intronic
1135921449 16:26652552-26652574 CTGGTGGGAGGTGATGAGGGAGG - Intergenic
1136508534 16:30721880-30721902 CTGGTGGCAGGCCATGTTAGAGG + Intronic
1139383374 16:66548598-66548620 CTGGGGGGAGAGGGTGGTGGTGG + Intronic
1140620567 16:76726035-76726057 GAGGTGGGAGATGGTGTTGGGGG - Intergenic
1141205825 16:81932576-81932598 CTGGTGGGTGACTATCTTGGAGG - Intronic
1142046024 16:87925817-87925839 CAGGTGGGAGACGGTGGTGGAGG - Intronic
1142751197 17:1988892-1988914 CTGGTGTGAGATGAGGCTGGAGG + Intronic
1143982291 17:10880347-10880369 CTGGTTGGTGAGGGTGTTGGTGG + Intergenic
1144254517 17:13453430-13453452 CTGGTGGGAGCTGATGTTCATGG + Intergenic
1145844150 17:28023109-28023131 GTGGTTGGAGAGGATGTGGGAGG + Intergenic
1146061294 17:29608828-29608850 CTGGTGGAAGCGGAGGTTGGAGG - Intronic
1146942774 17:36855291-36855313 CTGATGGGAGATGAGGCTGGAGG - Intergenic
1147168220 17:38604542-38604564 CTGGTGGGAGAGGACGGCGGAGG - Intronic
1148809340 17:50280216-50280238 CTGCTGGGAGACAATGGGGGTGG + Exonic
1148816807 17:50333872-50333894 CTGGTGGGAAACCATGATGGAGG + Intergenic
1149361024 17:55896144-55896166 CTCATGGGAGATGGTGTTGGTGG - Intergenic
1152241704 17:79164451-79164473 CTGGTGAGAGACGCTCCTGGGGG + Intronic
1152435007 17:80271096-80271118 CTGGTGGGAGGGTAGGTTGGTGG + Intronic
1156004043 18:32419279-32419301 ATGGAGGGAGACTATCTTGGTGG - Intronic
1159948890 18:74464459-74464481 CTGGTGGGAGATGTTGATGTGGG - Intergenic
1161320535 19:3638739-3638761 CTGGTGAGAGAGCATGTGGGTGG + Intronic
1161857369 19:6773432-6773454 CATGTGGGGGAAGATGTTGGCGG - Intronic
1162872779 19:13598848-13598870 CTGGTGGGAGACACTGGGGGTGG - Intronic
1162897887 19:13776343-13776365 CCGGTGGGAAATGATGTGGGTGG - Intronic
1162972214 19:14187587-14187609 GTGGGGGGAGACGCGGTTGGGGG - Intronic
1163612524 19:18308797-18308819 CTGGTGAGAGGGGAGGTTGGTGG - Intronic
1163712180 19:18853381-18853403 CTGGTGGGAGAGGAAAGTGGGGG + Intronic
1165723409 19:38095679-38095701 CAGGTGGGAGGTGATGGTGGGGG + Intronic
1167006926 19:46782356-46782378 GTGGTGGGAGAGGAGGCTGGGGG - Intronic
1167566728 19:50261584-50261606 CTGGAAGGAGACGATGATGTCGG - Exonic
1167729090 19:51240166-51240188 GTGGAGAGAGATGATGTTGGAGG - Intronic
1168374822 19:55867872-55867894 CTGATGTGAGTGGATGTTGGGGG + Exonic
925210931 2:2045378-2045400 CTGGTGGGAGAGGCTCTGGGAGG + Intronic
926483706 2:13429876-13429898 CTGTTGGGGGAGGATTTTGGGGG + Intergenic
929031225 2:37651687-37651709 CAGGTGGGAGAGGATGCAGGAGG + Intronic
930014686 2:46962309-46962331 GAGGAGGGAGACGATGTTGCAGG - Intronic
931522290 2:63112056-63112078 CTGGTGGGGGATGTTGATGGGGG - Intergenic
931632923 2:64317320-64317342 CTGCTGCGATGCGATGTTGGGGG - Intergenic
932461326 2:71883752-71883774 CTGGTGGGAGGGGGTGTTTGTGG - Intergenic
933490359 2:82978355-82978377 CTGGTGGGAGATAATCATGGGGG + Intergenic
933652156 2:84858263-84858285 CTGGTGGGAGACGATGTTGGAGG - Intronic
933832794 2:86224376-86224398 GTGGTGGCAGATGGTGTTGGGGG - Intronic
933842194 2:86296999-86297021 CTGGTGGGAGATGCTGAGGGAGG - Intronic
933893237 2:86789699-86789721 ATGGTGGGCGCCGGTGTTGGTGG + Exonic
934568728 2:95354798-95354820 AAGGTGGGAGAGGGTGTTGGGGG - Intronic
934939072 2:98486777-98486799 CTGGAGGGAGCTGATGTGGGAGG + Intronic
935526189 2:104170778-104170800 CTGGTGGGTGAAGAGGTTTGGGG - Intergenic
935608037 2:104990388-104990410 CTGGTAGGAGATGAGGTTGGAGG + Intergenic
937336505 2:121065619-121065641 CAGGGGAGAGACGGTGTTGGAGG + Intergenic
937850278 2:126626308-126626330 CTTGTGGGACACCATGGTGGTGG - Intergenic
938388273 2:130883207-130883229 CTGGTGTGAGAAGATGCTGTGGG - Intronic
940885355 2:158985112-158985134 CAGGTGAGAGATGATGTTTGAGG + Intronic
941378659 2:164763377-164763399 CTGGTGGGAGACCAAAATGGAGG + Intronic
946940343 2:224763544-224763566 TAGGTGGGAGATGATATTGGAGG + Intergenic
947406121 2:229779379-229779401 CTGTTGGGAGCAGATGCTGGGGG - Intronic
1171040294 20:21756550-21756572 TTGGCGGCAGATGATGTTGGGGG - Intergenic
1172387002 20:34541049-34541071 CTGGTGGGAGATGATGTTCATGG + Intergenic
1173163050 20:40666399-40666421 CTGGTGGGGGACTGTGTTGTGGG + Intergenic
1173688494 20:44940713-44940735 CTGGTAGGAGGTCATGTTGGTGG - Intronic
1173724380 20:45287100-45287122 GTGGTGGGAGCTGATGGTGGAGG - Intergenic
1173904127 20:46613585-46613607 CTGGGGGCAGACCTTGTTGGAGG + Exonic
1175656388 20:60774767-60774789 CCTGTGGGAGACCAGGTTGGGGG - Intergenic
1175874933 20:62224854-62224876 CAGGTGGGAGGCAATGGTGGCGG + Intergenic
1178263834 21:31124399-31124421 CTGGTGGGGGCTGATGTAGGAGG - Intronic
1181451696 22:23026952-23026974 CTGGTGGAAGAGCATGCTGGTGG - Intergenic
1181602520 22:23960893-23960915 CTGGTGGCAGACGCTGCAGGAGG + Intronic
1181605994 22:23980414-23980436 CTGGTGGCAGACGCTGCAGGAGG - Intronic
1183423461 22:37725395-37725417 CTGCTGGGAGAGGATGTCTGAGG - Exonic
1184970830 22:48018801-48018823 CAGCTGGGAGAGGATGATGGTGG + Intergenic
950210091 3:11116878-11116900 CTGGTGGGAGATGGAGGTGGTGG - Intergenic
950954179 3:17033743-17033765 CTGGTGGAAGTGGGTGTTGGAGG - Intronic
953846446 3:46430884-46430906 CTGTTGGGAGGCGGTGCTGGGGG - Intergenic
954997728 3:54896868-54896890 CTGGTGGGTGCCCTTGTTGGAGG + Exonic
955014868 3:55060327-55060349 TAAGTGGTAGACGATGTTGGTGG + Intronic
958998889 3:100938909-100938931 GTGGTGGTGGACGTTGTTGGGGG + Intronic
959207638 3:103331516-103331538 CTGATGGGAGACGTTTATGGTGG - Intergenic
960539992 3:118851527-118851549 GTGGTGGGAGAACAGGTTGGTGG - Intergenic
966941911 3:184753190-184753212 GTGGTGGGAGAAGAAGGTGGTGG + Intergenic
966941915 3:184753206-184753228 GTGGTGGGAGAAGAAGGTGGTGG + Intergenic
966941919 3:184753222-184753244 GTGGTGGGAGAAGAAGGTGGTGG + Intergenic
966941931 3:184753264-184753286 GTGGTGGGAGAAGAAGGTGGTGG + Intergenic
966942033 3:184753679-184753701 GTGGTGGGAGAAGAAGGTGGTGG + Intergenic
966942037 3:184753695-184753717 GTGGTGGGAGAAGAAGGTGGTGG + Intergenic
966942041 3:184753711-184753733 GTGGTGGGAGAAGAAGGTGGTGG + Intergenic
966942168 3:184754202-184754224 ATGGTGGGAGAAGAAGGTGGTGG + Intergenic
966942223 3:184754418-184754440 ATGGTGGGAGAAGAAGGTGGTGG + Intergenic
966942256 3:184754544-184754566 GTGGTGGGAGAAGAAGGTGGTGG + Intergenic
966942259 3:184754560-184754582 GTGGTGGGAGAAGAAGATGGTGG + Intergenic
966942263 3:184754576-184754598 ATGGTGGGAGAAGAAGGTGGTGG + Intergenic
966942273 3:184754621-184754643 GTGGTGGGAGAAGAAGATGGTGG + Intergenic
966942277 3:184754637-184754659 ATGGTGGGAGAAGAAGGTGGTGG + Intergenic
966942295 3:184754711-184754733 GTGGTGGGAGAAGAAGGTGGTGG + Intergenic
966942298 3:184754727-184754749 GTGGTGGGAGAAGAAGATGGTGG + Intergenic
966942302 3:184754743-184754765 ATGGTGGGAGAAGAAGGTGGTGG + Intergenic
966942306 3:184754759-184754781 GTGGTGGGAGAAGAAGGTGGTGG + Intergenic
966942310 3:184754775-184754797 GTGGTGGGAGAAGAAGGTGGTGG + Intergenic
966942318 3:184754804-184754826 GTGGTGGGAGAAGAAGGTGGTGG + Intergenic
966942328 3:184754849-184754871 GTGGTGGGAGAAGAAGATGGTGG + Intergenic
966942332 3:184754865-184754887 ATGGTGGGAGAAGAAGGTGGTGG + Intergenic
967855917 3:194117474-194117496 CAGGTGGGAGAGGAGGGTGGAGG - Intergenic
968044418 3:195616038-195616060 CTGGTGGGGGACGCTGATGATGG - Intergenic
968060207 3:195722089-195722111 CTGGTGGGGGACGCTGATGATGG - Intronic
970324672 4:14911100-14911122 CAGGTGGGAGACAATGATTGGGG + Intergenic
970448527 4:16144317-16144339 CTGGTGGGGGACGTTGATAGTGG + Intergenic
971226627 4:24759466-24759488 CTGGAGGGACAGGAAGTTGGGGG + Intergenic
971381296 4:26100676-26100698 CTGCTGGGAGATGATGTTTTAGG - Intergenic
972864297 4:43211364-43211386 CTGGTTGGGGAGGCTGTTGGGGG + Intergenic
976916059 4:90375921-90375943 CAGCTGGGAGGCCATGTTGGAGG + Intronic
977666247 4:99649963-99649985 CTGGTGGTAGATGGTGGTGGGGG + Exonic
982261486 4:153498122-153498144 TGGGTGGGAGAAGATGTAGGAGG + Intronic
984879425 4:184397630-184397652 CTGGTCGGAGCCAGTGTTGGGGG + Intronic
985566068 5:618158-618180 CTGGGGAGAGACGGTTTTGGAGG + Intronic
988792317 5:34620031-34620053 CTGCTGGGAGATGAGGTTGGAGG + Intergenic
992663298 5:78983001-78983023 CTGGTGGGGGAGGATGTTAGGGG + Intronic
997291413 5:132738334-132738356 CACGTGAGAGACGATGGTGGTGG - Intergenic
999161371 5:149502530-149502552 GGGGTTGGGGACGATGTTGGAGG + Intronic
1001034294 5:168286523-168286545 CTGGTGGGAGACGGGGGTGGGGG - Intergenic
1001634465 5:173199752-173199774 CAGGTGGGAGATGAGGCTGGAGG + Intergenic
1001679283 5:173544327-173544349 CTGGTGGGAGGCACTGCTGGGGG + Intergenic
1001722173 5:173865853-173865875 CTAGTGGGAGATTATGTTGGGGG + Intergenic
1005972326 6:30771042-30771064 CAGGCTGGAGATGATGTTGGAGG - Intergenic
1007627567 6:43255012-43255034 ATGGTGGGTGACGTTCTTGGTGG + Intronic
1007642923 6:43357277-43357299 CTGGTTGGAGTTGATGGTGGTGG - Exonic
1007969880 6:46040612-46040634 GTGGTGGATGACGATGTTGTTGG + Intronic
1011616599 6:89203224-89203246 CTGGTGAGAGAGGATGTCCGCGG - Intronic
1011695697 6:89910734-89910756 CTGGTGGGAAACCATGATGGAGG - Intergenic
1011849330 6:91606000-91606022 CAGGATGGAGACGATGGTGGTGG - Intergenic
1011939343 6:92823801-92823823 CTGCTGGTAGCCGATTTTGGGGG - Intergenic
1014633586 6:123817113-123817135 ATGGTGGGGGATGATTTTGGAGG + Intronic
1014945105 6:127488050-127488072 GTGGTGGGAGATGAGGTTGAAGG - Intronic
1019631430 7:2051802-2051824 CTGGTGGGGGATGGGGTTGGGGG - Intronic
1019848169 7:3527639-3527661 GTGGTGGGAGGTGAGGTTGGAGG + Intronic
1023418116 7:39950689-39950711 CTGGGCGGAGAAGAAGTTGGAGG + Exonic
1024213773 7:47228932-47228954 TTGGAGGGAGACGGGGTTGGAGG - Intergenic
1029367237 7:100124510-100124532 CCAGTGTGAGACCATGTTGGAGG + Exonic
1029470048 7:100748544-100748566 CTGATGGGAGACGTTGTTTCAGG + Intronic
1030389745 7:108912128-108912150 CTGGTAGGAGATGGGGTTGGGGG + Intergenic
1030764808 7:113395672-113395694 CTGGTGGGAGGTGATGGGGGTGG + Intergenic
1030944043 7:115694100-115694122 CTGGTGGGAGGTGATTATGGGGG - Intergenic
1031150114 7:118044444-118044466 CAGGTGGGAGAGGATGGTGCTGG + Intergenic
1032076145 7:128837126-128837148 ATGGAGGGAGACGATGGTGAGGG - Intronic
1032394290 7:131578158-131578180 ATGGTGGGAGATGGTGTTGCTGG - Intergenic
1033952513 7:146802490-146802512 CTGGTAGGAGATGATCATGGGGG + Intronic
1034476075 7:151282958-151282980 CTGATGGGAGATGATGATTGTGG - Intergenic
1034477396 7:151293663-151293685 TTGGTTGGAGATGATGTTGTAGG + Intergenic
1034849103 7:154477238-154477260 GTGGTGGGAGATCATGGTGGTGG - Intronic
1035388800 7:158491355-158491377 CTGCTGGCAGGCGATGGTGGTGG - Intronic
1035401777 7:158570417-158570439 ATGGTGGGAGAGGGTGCTGGAGG - Intronic
1035462869 7:159055948-159055970 ATGGTGGGAAAGGATTTTGGAGG + Intronic
1036578890 8:10054596-10054618 CTGGGGGCTGACGATGTTCGAGG - Exonic
1037584754 8:20268756-20268778 CTGGGGGGAGAGGCTGCTGGTGG + Intronic
1038384597 8:27130245-27130267 GGGGTGGGAGACAATGGTGGTGG + Intergenic
1042225193 8:66509821-66509843 CTGGTGGGGGATGTTGATGGGGG - Intronic
1045235497 8:100349521-100349543 CTGGAGGGAGGCGAGGTGGGAGG + Intronic
1045817599 8:106294708-106294730 CTGGTGGGAGGTGATCATGGAGG - Intronic
1048150053 8:131885431-131885453 CTGGAGGGAGAGGCTGCTGGGGG - Intergenic
1048224607 8:132572969-132572991 CTTGTGGGAGGAGAGGTTGGTGG - Intronic
1049482077 8:142830469-142830491 CTGGTGGGAGTAAATTTTGGAGG - Intergenic
1051297393 9:15610996-15611018 CTGGTGGGAGGAGATCATGGGGG + Intronic
1053421599 9:37983373-37983395 CTGGTGGGAGATGATGCTGGAGG + Intronic
1054822945 9:69542202-69542224 CTGGTGGGAGATGTTAATGGTGG - Intronic
1056634857 9:88323130-88323152 CTGGTGGGATGGGATGATGGAGG + Intergenic
1057066597 9:92058643-92058665 CTGGAAGGAGACCATGTTAGGGG + Intronic
1057173408 9:92977069-92977091 CTGGGAGGAGACGATGTGAGTGG + Intronic
1059425832 9:114220387-114220409 CTGGTGGGAGAAGGTGTTCATGG + Intronic
1061233898 9:129331217-129331239 TTGTTTGGAGACCATGTTGGAGG + Intergenic
1203779537 EBV:93435-93457 CTGGTGGGAGAGGTTGTGCGTGG - Intergenic
1186507927 X:10109050-10109072 CTGGTGAGAGATGATCTGGGTGG - Intronic
1187388833 X:18872594-18872616 GTGGTCTGAGATGATGTTGGTGG + Intergenic
1187683128 X:21788133-21788155 TTGGTGGTAGATGATGTTGTAGG + Intergenic
1190721955 X:53156068-53156090 CTGGTTGGAGATGTTGTTTGTGG + Intergenic
1195232002 X:102859584-102859606 CTGTTGGGGGACCATGGTGGGGG - Intergenic
1195235230 X:102890329-102890351 CTGGTGGGAGATGAAGTTGAAGG + Intergenic
1198410836 X:136365973-136365995 CTGGTGGGGGATGTTGATGGTGG - Intronic
1199174032 X:144763673-144763695 CTGGGGGCAGGGGATGTTGGAGG + Intergenic
1201612982 Y:15863830-15863852 CTGGTGGAAGACGTTGGTAGTGG + Intergenic