ID: 933652563

View in Genome Browser
Species Human (GRCh38)
Location 2:84861110-84861132
Sequence TACAGGGAGGTGAGGCCAAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 210
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 192}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933652560_933652563 -10 Left 933652560 2:84861097-84861119 CCGTAGATCGATTTACAGGGAGG 0: 1
1: 0
2: 0
3: 2
4: 50
Right 933652563 2:84861110-84861132 TACAGGGAGGTGAGGCCAATAGG 0: 1
1: 0
2: 0
3: 17
4: 192
933652557_933652563 11 Left 933652557 2:84861076-84861098 CCTGGCGATCGATTTACAGGGCC 0: 1
1: 0
2: 1
3: 0
4: 16
Right 933652563 2:84861110-84861132 TACAGGGAGGTGAGGCCAATAGG 0: 1
1: 0
2: 0
3: 17
4: 192
933652554_933652563 18 Left 933652554 2:84861069-84861091 CCATCAGCCTGGCGATCGATTTA 0: 1
1: 0
2: 0
3: 2
4: 29
Right 933652563 2:84861110-84861132 TACAGGGAGGTGAGGCCAATAGG 0: 1
1: 0
2: 0
3: 17
4: 192

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933652563 Original CRISPR TACAGGGAGGTGAGGCCAAT AGG Intronic
902245140 1:15115735-15115757 CACAGAGAGGTGAGGCCACTGGG - Exonic
903027273 1:20438324-20438346 TACCAGGAGGTGAGGACCATCGG - Intergenic
903320900 1:22542667-22542689 GACAGGGAGTTGGGGTCAATGGG - Intergenic
905392150 1:37643537-37643559 CACAGAGAGTTGAGGCCATTTGG - Intergenic
907238344 1:53066714-53066736 CTCAGGGAGCTGAGCCCAATGGG - Intronic
907280733 1:53345638-53345660 TACAGGGTGATGAGGGCCATGGG - Intergenic
907393901 1:54176662-54176684 AAAGGGGAGGTGAGGCCAGTGGG - Intronic
908820533 1:68081474-68081496 TGAAGGGAGGAGAGGACAATGGG + Intergenic
912968271 1:114256415-114256437 TACATGGATATGAGGGCAATAGG + Intergenic
915082425 1:153361173-153361195 GTCAGGGAGGTGAGCCCAAGGGG - Intergenic
915355323 1:155252180-155252202 TAGATGGAGGTGAGGCTAAAGGG - Intronic
915999097 1:160597346-160597368 TATAGGGAGGTGGGGCCTAATGG + Intergenic
918139125 1:181705562-181705584 TACAGGGAAGTAAGGTGAATTGG - Intronic
918152979 1:181814510-181814532 TATTTAGAGGTGAGGCCAATGGG + Intergenic
921928535 1:220733371-220733393 TACAGGGCGGTGATGCCTACAGG + Intergenic
923386246 1:233467533-233467555 TATGTGGAGGTCAGGCCAATGGG + Intergenic
1063957131 10:11277414-11277436 TCCAGGGAGGTGAGGGCAGAGGG - Intronic
1064318268 10:14277871-14277893 TAAAGGGAGCTCAGGCCATTGGG - Intronic
1064904145 10:20327373-20327395 TACAGGTAGGTGTAGCCAAAAGG + Intergenic
1067279880 10:44863172-44863194 CTCAGGGAGCTGATGCCAATTGG - Intergenic
1067292482 10:44953866-44953888 GATAGGGAGGTGAGGACAAAGGG + Intergenic
1068072260 10:52209861-52209883 CACAGGGAGGGGAGGTCAACTGG - Intronic
1069536485 10:69257445-69257467 TACAGTGGGATTAGGCCAATGGG - Intronic
1069915989 10:71787171-71787193 TTCACGGAGGTGTGGCAAATGGG - Intronic
1073390905 10:103175763-103175785 TCCAGGGTGCTGAGGCCAAGGGG + Intronic
1074908249 10:117883846-117883868 TACAGGGAGTTGAAGTCACTGGG + Intergenic
1075548270 10:123372733-123372755 CACAGGGAGGTCAGGCCAGAAGG + Intergenic
1076148835 10:128146837-128146859 TGCAGGGAGGTGAGACCACGTGG + Intergenic
1078085798 11:8232431-8232453 TACAGGGAGGTGTGGGGAAATGG + Intronic
1079116178 11:17641925-17641947 AACAGGGAGGTGGTGCCATTGGG - Exonic
1079260454 11:18873549-18873571 TACAGGGAGGTGGGCCATATGGG - Intergenic
1079667362 11:23122785-23122807 CACAGGGATGAGAGGCCAAGTGG - Intergenic
1080020339 11:27553413-27553435 TCCAGAGTGGTGAGGCCAAGTGG - Intergenic
1080758100 11:35221523-35221545 TGCAGGGGGGTCTGGCCAATAGG - Intronic
1080981895 11:37417663-37417685 TACAAAGAAGTGAGCCCAATGGG + Intergenic
1083717149 11:64583995-64584017 TAAAGGGACGCGAGGCCACTGGG - Intergenic
1084195092 11:67520037-67520059 TTCCGGGAGGTGCGGCCACTGGG - Exonic
1086983233 11:93221636-93221658 TACAGGCAGGTGTGGGCAAAAGG - Intergenic
1087622359 11:100556832-100556854 TACAGGGAGGTAAAGCAATTTGG + Intergenic
1087725837 11:101715760-101715782 GACTAGGAGGTGGGGCCAATGGG + Intronic
1088352782 11:108909178-108909200 TCCAGGGAGGTGGGGGGAATAGG - Intronic
1088546534 11:110965135-110965157 TACAGGTAGGTGAGTCCCAGTGG + Intergenic
1088606539 11:111539018-111539040 TACAGGGAGGTGTGGAGAATTGG + Intergenic
1089613525 11:119682570-119682592 TACAGAGAGGTGAAGTCATTTGG - Intronic
1089670909 11:120056444-120056466 CTCAGGCAGGAGAGGCCAATGGG - Intergenic
1089868380 11:121651572-121651594 TATAAGGAGGTGAGGCCTTTGGG - Intergenic
1091262758 11:134246891-134246913 TAAAGGGAAGGGAGGCCAATGGG - Exonic
1093196500 12:16135727-16135749 TATAGGGAGGTGGGGCCTAATGG + Intergenic
1095624604 12:44299893-44299915 TACTGGGAGGGAAAGCCAATTGG + Intronic
1099168204 12:79333379-79333401 TATTAGGAGGTGAGGCCAATGGG - Intronic
1100861931 12:98815621-98815643 CACAGGGAGGTGAGGTCATCAGG - Intronic
1101089157 12:101266970-101266992 TACAGGGAGGGGTGGAGAATTGG - Intergenic
1106129810 13:26930891-26930913 GACAGTGAGGGGATGCCAATGGG + Intergenic
1106694681 13:32160563-32160585 TCCATAGAGGTGAGGCCCATCGG + Intronic
1108582924 13:51842166-51842188 TACAGGGATATGGGGCCACTGGG + Intergenic
1109832539 13:67811245-67811267 CACAAGGATGTGAGGCAAATGGG - Intergenic
1112640380 13:101267429-101267451 TACAGGGAGGTGAATTCAATTGG - Intronic
1113139431 13:107130649-107130671 TACTAGGAGGTGAGGCCTTTGGG + Intergenic
1113455560 13:110446231-110446253 TGCAGGGAGGGGAGACCATTAGG + Intronic
1116987452 14:51236577-51236599 TATTGGGAGGTGGGGCCTATTGG - Intergenic
1120749884 14:88187499-88187521 TACGGGGAAGTGAGCCCAATGGG - Intronic
1121724908 14:96140169-96140191 TAGAGGGAGGTGAGTTGAATAGG - Intergenic
1127456383 15:59159423-59159445 TCCAGTGGGGTGAGGCCTATAGG + Intronic
1128329431 15:66745981-66746003 TGCAGGCAGGTGTGGCCATTAGG + Intronic
1129199216 15:73988848-73988870 TGCAGGGAGGTCAGGCCCACTGG + Intronic
1130132723 15:81157727-81157749 GACTGGGAGGTGAGGGAAATGGG + Intergenic
1132771617 16:1566842-1566864 GCCAGGGAGGTGGGGCCACTGGG - Intronic
1138206549 16:55129828-55129850 CACAGGGAGGAGAAGGCAATAGG + Intergenic
1138413870 16:56860182-56860204 TACTGGGAGATGAGGCTAAAAGG - Intergenic
1138510745 16:57507360-57507382 AACAGGGAGCTGAGCCCACTTGG + Intergenic
1138813612 16:60178865-60178887 CACAAGGAGGTGAGGCTCATTGG - Intergenic
1140185916 16:72771927-72771949 TACTGAGAGGTGAAGCCAACTGG + Intergenic
1141185497 16:81784180-81784202 TAGAGGGAGGTGGGGGCAAAGGG + Intronic
1141743818 16:85912817-85912839 TCCAGGGCGTTGAGGGCAATTGG + Intronic
1143444317 17:6998433-6998455 CACAGGGAGATGAGGACAAGAGG + Intronic
1143731845 17:8886063-8886085 TACCGGGAGGTGGGGCCATGGGG - Intronic
1144098433 17:11922798-11922820 TACTGGGAGGTGTGGCCAGTAGG - Intronic
1146173540 17:30650452-30650474 TGCTGGCAGGTGAGGCCAAGGGG + Intergenic
1146437927 17:32868602-32868624 GGTAGGGAGGTGAGGCCATTCGG + Intronic
1146630941 17:34468903-34468925 TTCAGGAAGGTGCAGCCAATGGG - Intergenic
1150693579 17:67385094-67385116 TTCTGGGAGGTGAAGCCAGTTGG + Intronic
1151215139 17:72571961-72571983 TTTAGGGAGGTCAGGGCAATGGG - Intergenic
1151624258 17:75266837-75266859 GCCAGGGAGCTGAGGCCAGTTGG + Exonic
1156449839 18:37260839-37260861 TCCAGGGAGGGGAGGCCGAAGGG - Intronic
1157096016 18:44685999-44686021 CACAGGGAGGGGAGGCGAAGTGG + Intronic
1161598563 19:5165765-5165787 GACTGAGAGGTGAGGCCAACTGG - Intronic
1162226327 19:9225640-9225662 TTTAGGGAAGAGAGGCCAATAGG - Intergenic
1162988882 19:14289613-14289635 TGCTGGCAGGTGAGGCCAAGGGG - Intergenic
1163809408 19:19421252-19421274 GCCAGGGAGGTGAGGGCAGTAGG + Intronic
1165023230 19:32940550-32940572 TCTAGGGAGGGTAGGCCAATAGG - Intronic
1166570848 19:43796153-43796175 TACTGGGAGGTGGGGCCTTTGGG - Exonic
1167349521 19:48965718-48965740 TAGCGGGAGGCGAGGCCAAGGGG - Intronic
1168453302 19:56483118-56483140 AGAAGGGAGGTGAGGCCAGTGGG + Intergenic
929254225 2:39791960-39791982 TACTGAGAGGTGAGGCCAGCTGG - Intergenic
929618878 2:43334811-43334833 TACAGGGCACTGAGGCCACTGGG + Intronic
929625025 2:43397692-43397714 TTCAGAGAGGTGAGGCCAAGTGG + Intronic
929872868 2:45773245-45773267 TACAGGAGGGTGAGGCCTTTTGG + Intronic
930191377 2:48463475-48463497 CACAGGGAGTTGAGGTGAATGGG + Intronic
930849479 2:55943453-55943475 TACAGGGAGGGGTGACAAATTGG - Intergenic
932013049 2:67997546-67997568 TACATGGGGGTGAGGCTAACAGG + Intergenic
933652563 2:84861110-84861132 TACAGGGAGGTGAGGCCAATAGG + Intronic
934512288 2:94955001-94955023 GACAGGGAAGTGAGACCAACAGG - Intergenic
935664297 2:105496771-105496793 TACAGGGATGTGAGGAGAAGGGG + Intergenic
935832975 2:107019651-107019673 TACAGGGCGCTGAGGCAAGTAGG - Intergenic
936045347 2:109183784-109183806 TATAAGGAGGTAAGGCCAAGGGG + Intronic
937348019 2:121139613-121139635 TATAGGGAGGTGTGGAAAATTGG - Intergenic
938115178 2:128597584-128597606 TACATGGAGGACAGGCCAAAGGG + Intergenic
938757174 2:134391635-134391657 TACTAGGAGGTGAGGCCTGTGGG - Intronic
941833073 2:169983673-169983695 TACAGGGAGGAGTGGAGAATTGG + Intronic
941838462 2:170052677-170052699 GACAGGGAGGTGGGGAAAATGGG + Intronic
942325459 2:174772605-174772627 GACAGGGAGGAGTGGCCAAAAGG + Intergenic
945063676 2:205930231-205930253 TCCGGGGAGGAGAGGCCAGTTGG - Intergenic
948263034 2:236618259-236618281 AACAGGGAGGTGAGTCCCACGGG + Intergenic
948273683 2:236692452-236692474 TTCCCAGAGGTGAGGCCAATTGG + Intergenic
948308546 2:236968320-236968342 TTCAGAGAGGTGGGGCCAAACGG + Intergenic
1169317807 20:4607955-4607977 GATGGGGAGGTGAGGCCAGTGGG - Intergenic
1169520753 20:6370451-6370473 TACAGGGAGGTGTGAAGAATTGG + Intergenic
1169726825 20:8743553-8743575 TGCAGGGAGGTGAGGCAAGCAGG - Intronic
1169802222 20:9522036-9522058 CACAGGGAGGTGAAGCGAATTGG + Intronic
1170177756 20:13491439-13491461 TACAGGGAAGTGAAGTGAATGGG - Intronic
1171100581 20:22379861-22379883 TACAGGGAGCTGTGGAGAATTGG + Intergenic
1172182188 20:33010271-33010293 TACAGAGAGGTGAGGGCACCTGG - Intronic
1173759321 20:45545950-45545972 TAGAGGGAGGAGAGGTCACTGGG - Intronic
1175534826 20:59702254-59702276 GACAGGGAGGTGATGACAGTGGG - Intronic
1178214073 21:30573734-30573756 CACAGGAAGGTGAGTCCAATGGG + Intergenic
1180011417 21:45053915-45053937 TACAGGGAGGAGAGGGTGATGGG + Intergenic
1182421385 22:30250350-30250372 CACAGGGAGGTCAGCACAATGGG - Intergenic
1183380792 22:37489551-37489573 TAGAGAGGGCTGAGGCCAATTGG - Intergenic
1183396099 22:37571735-37571757 AAGAGGGACGTCAGGCCAATGGG - Intronic
1184444415 22:44539100-44539122 TACAGGGAGTTGAGTCAAGTTGG - Intergenic
950444340 3:13027526-13027548 GACAGGAAGGTGAGGACAAGAGG + Intronic
950692245 3:14669081-14669103 TACAGTGAGGTGTGGCCCACAGG - Intronic
952712431 3:36444714-36444736 TACAGGGAGGGGTGGAAAATGGG + Intronic
953567321 3:44043867-44043889 TACAGGGTGGTGAGGTTTATGGG - Intergenic
953885074 3:46710420-46710442 TACACAGAGCTAAGGCCAATGGG + Exonic
954608281 3:51930443-51930465 ATCAGGGAGGTGAAGGCAATAGG - Intergenic
955409716 3:58647658-58647680 TGAAGGGAGATGAGGCCAAGGGG + Intronic
955563855 3:60223292-60223314 TACAGGGAGCTTAAGTCAATAGG + Intronic
966830638 3:184005197-184005219 TACAGAGAGGTGAGGCTAAATGG + Intronic
968483138 4:845662-845684 CACAGGGAGAGGAGGCCCATGGG + Intergenic
969615381 4:8249267-8249289 TCCAGGGAAATGGGGCCAATAGG + Intergenic
970609875 4:17714980-17715002 TGCAGGGAGGTGAGGGGAAGGGG - Intronic
979726969 4:123973870-123973892 TACAGGGAGGGTAAGCCACTTGG + Intergenic
983399458 4:167244730-167244752 AACAGGGAGGTGAGTTCACTGGG - Intergenic
984270351 4:177541703-177541725 GACAGAGAGGTGACGCCAACTGG - Intergenic
984338694 4:178425684-178425706 TATTGGAAGGTGAGGTCAATTGG - Intergenic
985996513 5:3600150-3600172 TGCAGGAAGGTGAGGGCCATGGG - Exonic
986018909 5:3782678-3782700 TTCATGGAGGTGAGGAAAATGGG - Intergenic
986694736 5:10341588-10341610 TACTAGGAGGTGAGGCCTTTGGG - Intergenic
987001775 5:13667263-13667285 TACAGGGAGGCCAGGCCAAAAGG - Intergenic
990283213 5:54274031-54274053 GACAGAGAGGTGAGGCAACTAGG + Intronic
990927997 5:61051467-61051489 TCCAGGAATGTGAGGCCATTAGG + Intronic
991283890 5:64947731-64947753 TACAAAGAGGGGAGGCCCATAGG - Intronic
994130961 5:96226791-96226813 TCCAGGGAGGAGCGGCCAAGAGG - Intergenic
1001542644 5:172550325-172550347 CAAAGGGAGGAGAGGCCAATGGG - Intergenic
1002542116 5:179913240-179913262 TACAGAGAGGAGGGGCCAACAGG + Intronic
1002603730 5:180370080-180370102 TGTAGGGAGGGGAGCCCAATGGG + Intergenic
1003249558 6:4413990-4414012 TACTGAGAGGTGAAGCCAACTGG + Intergenic
1004039899 6:11965234-11965256 TACTGAGAGGTGAGGCCTAAAGG - Intergenic
1007336159 6:41156731-41156753 TGAAGGGAAGTGAGGCCATTTGG - Intergenic
1007980590 6:46152333-46152355 TATAGGGAGTTGATGCCCATGGG + Intergenic
1011047537 6:83102153-83102175 TGCAGGAAGGTCAGGTCAATAGG - Intronic
1013130222 6:107225566-107225588 TACAAGGAGGTGGGGCTAATTGG + Intronic
1013756244 6:113465093-113465115 TACAGGGAGAAGAGGTCAGTGGG - Intergenic
1013844271 6:114430671-114430693 TGCTGGGAGGTGAGGCCTAGTGG + Intergenic
1016172964 6:141041925-141041947 TACAGGGAGGTGTGGAGGATGGG - Intergenic
1017733486 6:157339063-157339085 TATTTGGAGGTGAGGCCTATGGG + Intergenic
1017797896 6:157864309-157864331 TATTGGGAGGTGCGGCAAATGGG - Intronic
1018267909 6:162044783-162044805 TTCATGGAGGTGAGGCCCAAGGG - Intronic
1019919603 7:4155027-4155049 TGCAGGGAGGTGAGGCAGGTTGG + Intronic
1024789584 7:52949141-52949163 TAAAGGGAGCTGAGTTCAATAGG - Intergenic
1030339576 7:108361886-108361908 TACAGAGAAGTAAGGCCAATAGG - Intronic
1031990702 7:128197175-128197197 TTGAGGCAAGTGAGGCCAATGGG - Intergenic
1032882034 7:136100333-136100355 TGCAGGGTGGTGAAGCCAATAGG + Intergenic
1033710930 7:143942954-143942976 TATTGGGAGGTGAGACCACTGGG - Intergenic
1034954530 7:155326437-155326459 TACTAGGAGGTGAGGCCTTTAGG - Intergenic
1035739316 8:1914277-1914299 TCCAGGGATGTGTGGCCAAGTGG + Intronic
1036702979 8:11025449-11025471 TGCAGGGAGGGGTTGCCAATGGG + Intronic
1041495972 8:58485733-58485755 CACAGAGAGGTGAGCCCCATTGG - Intergenic
1044085220 8:87935506-87935528 TACTAGGAGGTGAGGGCTATGGG - Intergenic
1044684611 8:94814873-94814895 TATTGGGAGGTGAGGCCTTTTGG + Intronic
1046308395 8:112400347-112400369 TATTGGGAGGTGGGGCCATTAGG - Intronic
1047408326 8:124603638-124603660 TACAGGGAGGGGAGGCAGAGAGG + Intronic
1049475218 8:142794167-142794189 TCCAGGGAGGAGAGGCCACCAGG - Intergenic
1051608270 9:18937585-18937607 TATTGGGAGGTGAGGCCTTTTGG + Intronic
1052005289 9:23340527-23340549 AACAGTGAGGTGAGGCCTAATGG + Intergenic
1053145371 9:35708257-35708279 TAGAGGGAGGTGAGGCATGTGGG - Intronic
1053602540 9:39624953-39624975 CACTGAGAGGTGAGGCCAGTTGG - Intergenic
1054250998 9:62717482-62717504 CACTGAGAGGTGAGGCCAGTTGG + Intergenic
1054565105 9:66751995-66752017 CACTGAGAGGTGAGGCCAGTTGG + Intergenic
1054977057 9:71159985-71160007 CATAGGGAGGTGAGTCCTATAGG - Intronic
1057562298 9:96138171-96138193 TATTGGGAGGTGAGGCCTTTGGG + Intergenic
1058815919 9:108682811-108682833 GAGAGGGAGGTGGGGCCAAGGGG - Intergenic
1062443825 9:136585109-136585131 GACAGGGAGATGGGGCCAGTGGG + Intergenic
1186401755 X:9266842-9266864 ATCAGGGAGAGGAGGCCAATAGG - Intergenic
1186957875 X:14702891-14702913 TACAGAGAGGAGAGGACAAGGGG + Intronic
1190141442 X:47849158-47849180 TACAGGGGGGTGAAGTTAATGGG + Intronic
1190401977 X:50046359-50046381 GACAGGGAGGTGAGGAAAAAAGG - Intronic
1190876833 X:54466005-54466027 TACAGGCCAGTGAGGCCAAGAGG + Intronic
1192446515 X:71215282-71215304 GACAGGGAGGTGAGGAGACTGGG + Exonic
1192633063 X:72791808-72791830 GACAGGGAGGTGAGGTCAGAAGG - Intronic
1192648646 X:72928993-72929015 GACAGGGAGGTGAGGTCAGAAGG + Intronic
1193520989 X:82528570-82528592 AGCTGGGAGGTGAGGCCATTGGG + Intergenic
1194363928 X:92990232-92990254 TATTGAGAGGTGAGGCCAACTGG - Intergenic
1195621581 X:106961486-106961508 TACTGAGAGGTGAGGCCAGTTGG + Intronic
1196895618 X:120332876-120332898 TACAGAAAGGTGAGTGCAATTGG - Intergenic
1197128385 X:122974306-122974328 TAAAGGGAGGTCTTGCCAATGGG - Intergenic
1198286881 X:135199861-135199883 TATAGGGAGGTGGGGCCTTTGGG - Intergenic
1200039321 X:153354276-153354298 TACAGGAAGGACAGGCCAACAGG + Intronic
1202044637 Y:20726173-20726195 TACAGGGAGGGGAACACAATGGG + Intergenic