ID: 933654978

View in Genome Browser
Species Human (GRCh38)
Location 2:84879997-84880019
Sequence CCCCCCCACCCCCGCGTCGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 501
Summary {0: 1, 1: 0, 2: 4, 3: 49, 4: 447}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933654961_933654978 18 Left 933654961 2:84879956-84879978 CCTCTAAATTCCAGCCCCCACTC 0: 1
1: 0
2: 2
3: 20
4: 283
Right 933654978 2:84879997-84880019 CCCCCCCACCCCCGCGTCGCGGG 0: 1
1: 0
2: 4
3: 49
4: 447
933654964_933654978 3 Left 933654964 2:84879971-84879993 CCCCACTCCCTCAACCCACCCCC 0: 1
1: 2
2: 14
3: 193
4: 1549
Right 933654978 2:84879997-84880019 CCCCCCCACCCCCGCGTCGCGGG 0: 1
1: 0
2: 4
3: 49
4: 447
933654962_933654978 8 Left 933654962 2:84879966-84879988 CCAGCCCCCACTCCCTCAACCCA 0: 1
1: 1
2: 17
3: 130
4: 1269
Right 933654978 2:84879997-84880019 CCCCCCCACCCCCGCGTCGCGGG 0: 1
1: 0
2: 4
3: 49
4: 447
933654967_933654978 -4 Left 933654967 2:84879978-84880000 CCCTCAACCCACCCCCAACCCCC 0: 1
1: 0
2: 19
3: 313
4: 3106
Right 933654978 2:84879997-84880019 CCCCCCCACCCCCGCGTCGCGGG 0: 1
1: 0
2: 4
3: 49
4: 447
933654965_933654978 2 Left 933654965 2:84879972-84879994 CCCACTCCCTCAACCCACCCCCA 0: 1
1: 0
2: 15
3: 150
4: 1221
Right 933654978 2:84879997-84880019 CCCCCCCACCCCCGCGTCGCGGG 0: 1
1: 0
2: 4
3: 49
4: 447
933654968_933654978 -5 Left 933654968 2:84879979-84880001 CCTCAACCCACCCCCAACCCCCC 0: 1
1: 4
2: 45
3: 505
4: 4031
Right 933654978 2:84879997-84880019 CCCCCCCACCCCCGCGTCGCGGG 0: 1
1: 0
2: 4
3: 49
4: 447
933654966_933654978 1 Left 933654966 2:84879973-84879995 CCACTCCCTCAACCCACCCCCAA 0: 1
1: 0
2: 31
3: 271
4: 2247
Right 933654978 2:84879997-84880019 CCCCCCCACCCCCGCGTCGCGGG 0: 1
1: 0
2: 4
3: 49
4: 447
933654963_933654978 4 Left 933654963 2:84879970-84879992 CCCCCACTCCCTCAACCCACCCC 0: 1
1: 4
2: 11
3: 170
4: 1581
Right 933654978 2:84879997-84880019 CCCCCCCACCCCCGCGTCGCGGG 0: 1
1: 0
2: 4
3: 49
4: 447

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933654978 Original CRISPR CCCCCCCACCCCCGCGTCGC GGG Intronic
900180381 1:1308539-1308561 CCCCCCCTCCCCCCCGGCCCCGG - Intronic
900226035 1:1534115-1534137 CCCTCCCACCCCTGCCTTGCCGG + Exonic
900244552 1:1631234-1631256 ATCCCCCACCCCCGCCCCGCGGG + Intergenic
900462194 1:2807036-2807058 CCACCCCACCCCCACCCCGCAGG - Intergenic
901012363 1:6209045-6209067 CGCCCCCACCCCCAAGTCCCCGG - Intronic
901401917 1:9020553-9020575 CCCCCCCACCCCCCCGCCTTTGG + Intronic
901825646 1:11859243-11859265 CCTCCCCACCCCACCGTTGCTGG + Intergenic
902873630 1:19328454-19328476 CCCTCCCACCCCCACGCTGCAGG - Intronic
903233870 1:21937346-21937368 CCGCCCCGCCCCCGCAGCGCCGG + Intergenic
903438715 1:23371140-23371162 CCACCCCGCCCCCGCCCCGCAGG - Exonic
904463648 1:30695031-30695053 CCCCACCACCCCCTCCTCCCAGG - Intergenic
904601968 1:31678185-31678207 CCTCCCCACCCCCGCCACCCTGG - Intronic
904940427 1:34162239-34162261 CCTCCCCACCCCAGCCTCCCTGG - Intronic
905028265 1:34865711-34865733 CCCCCCCTCCCCCACCCCGCGGG - Exonic
905046222 1:35004689-35004711 CCTCCCCACCCCCGCCTCAGGGG - Intronic
905741435 1:40374254-40374276 CCCCACCACCCCGGCGCGGCTGG - Intronic
906117862 1:43367719-43367741 CTCCCCCACACCCCCGTCTCTGG - Exonic
906475591 1:46167318-46167340 TCCCCCCACACCCTCGTCTCTGG - Intronic
906945791 1:50293078-50293100 CAGCCCCACCCCCGAGTAGCTGG - Intergenic
907038383 1:51236505-51236527 CCCCCCCATCGCTGCCTCGCAGG + Exonic
907388494 1:54141173-54141195 GCCCCCCACCCTCGTGTCTCTGG - Exonic
908131837 1:61082368-61082390 CCCCCTCCCCCCCGCGGCGGCGG + Intronic
910773990 1:90856621-90856643 ACCCCCCACCCCCACCTCCCAGG + Intergenic
910875699 1:91875771-91875793 CCCCCCCCCGCCCGAGTAGCTGG - Intronic
910935094 1:92480844-92480866 CGCCCCGGCCCCCGCGCCGCCGG + Exonic
911184032 1:94885984-94886006 CCCCTCCACCCCCACCTCGGTGG - Intronic
911440568 1:97921039-97921061 CCGCTCCGCCCCCGCGCCGCCGG - Intronic
912494728 1:110084161-110084183 CCCCCGCACCCTCGCGTGGCCGG + Intergenic
913518264 1:119623296-119623318 CGCCGCCGCCCCCGCGCCGCTGG + Exonic
914870973 1:151473493-151473515 CCTCCACACCCACGCGCCGCGGG - Intergenic
914871500 1:151478824-151478846 CCCCCCCGCCCCCCCATCCCAGG + Intergenic
915473489 1:156139114-156139136 CACCCCCACCCCTGCCTGGCAGG - Exonic
915967839 1:160327459-160327481 CCCCCCCAGCCCCGCCCCCCGGG - Intronic
915977464 1:160400553-160400575 CCCCCTCCCCCCTGCGCCGCCGG + Intergenic
916144451 1:161726748-161726770 CCCACCCAGCGCCGCGCCGCGGG - Exonic
917527651 1:175803137-175803159 CCACCCCACCCCTGCTTCTCAGG + Intergenic
918269851 1:182887362-182887384 CCCCCCTACCACCTCCTCGCTGG - Exonic
919194231 1:194263314-194263336 CCCCCCCCCCCCCCAGTAGCGGG + Intergenic
921389901 1:214606753-214606775 CACCCCCACCCCCAGGTCACTGG + Intronic
922196184 1:223362948-223362970 CCCCCCCGCCCCCGCTTCCTTGG + Intronic
922467982 1:225857375-225857397 CCCCCCCCCCCCCGCCCCGCCGG - Intronic
922570695 1:226633226-226633248 CCCCACCACCCCGGGGTCTCTGG - Exonic
922615247 1:226957282-226957304 CCCCCCCCCCCCCACCTCCCTGG + Intronic
922815610 1:228446700-228446722 CCCCCCCAACCCCCCAACGCTGG - Intergenic
1062890570 10:1056766-1056788 CCGCCCCAGTCCCGCGCCGCTGG - Intronic
1062932678 10:1363282-1363304 CCCCGCCACCCCCGCGGCCCCGG - Exonic
1064253149 10:13722337-13722359 CCCCCCCACCTCAGCCTCACAGG + Intronic
1065099916 10:22321924-22321946 CCCGCCGACTCCCGCGGCGCCGG + Intronic
1065101538 10:22336318-22336340 GCCCGCCACCCCCGCCCCGCAGG + Intergenic
1065188663 10:23192183-23192205 CCCGCCCACCGCCGCGCCTCCGG + Intergenic
1066196715 10:33107092-33107114 GCCCCCCACCCCACTGTCGCAGG + Intergenic
1066402624 10:35090374-35090396 CTCCCCACCCCCCGCGTCTCCGG - Intronic
1067373176 10:45703536-45703558 CACCCCCACCCCCCCGACCCAGG - Intergenic
1067386600 10:45822586-45822608 CACCCCCACCCCCCCGACCCAGG + Intergenic
1067447669 10:46362014-46362036 CACCCCCACCCCCCCGACCCAGG - Intergenic
1067589710 10:47498746-47498768 CACCCCCACCCCCCCGACCCAGG + Intergenic
1067636834 10:48006853-48006875 CACCCCCACCCCCCCGACCCAGG + Intergenic
1067972859 10:50991883-50991905 CCTCCCCACCCCCACGCCACAGG - Intronic
1069043324 10:63717582-63717604 CCCCCCCGCCCCCAAGTAGCTGG + Intergenic
1069769360 10:70887930-70887952 CCCACCCACCCCCGGGGCGGGGG - Intronic
1070407694 10:76111794-76111816 CCCCCCCACCCCCATTTCGGCGG - Intronic
1070572352 10:77649945-77649967 CCCCCCCACCCCAGCCTCAGAGG - Intergenic
1070708455 10:78658564-78658586 CCCCCCCACCCCCGCTGTACTGG - Intergenic
1073102286 10:101012718-101012740 CCTCCCCACCCCCACATCCCAGG + Intronic
1074137952 10:110644237-110644259 GGCCCCCGCCCCCGCGTGGCCGG + Intergenic
1075774098 10:124968432-124968454 GCCCCCCACCCCGGCTTCACTGG - Intronic
1075801947 10:125159712-125159734 CCCCCCCACCCTCGCCTCGTAGG + Intronic
1076035636 10:127196596-127196618 CCGCCCCACCTCCGCCCCGCGGG - Intronic
1076200940 10:128557384-128557406 CCACCCCACCCCCGCAACACAGG + Intergenic
1076793124 10:132787005-132787027 CCCCCCCGCCCCCACGGCACCGG + Intergenic
1077405304 11:2379899-2379921 CCCCTCCACCCTGGTGTCGCAGG + Intronic
1077636094 11:3841700-3841722 CCCGCCCACCCGCGGGTCGCCGG - Intergenic
1077870684 11:6259553-6259575 CGCCCCCACCCCCGATTCCCAGG - Intergenic
1078345151 11:10541240-10541262 CCCCGCCCCCCGCGCGTTGCCGG + Intergenic
1079460348 11:20672975-20672997 CCCCCCCCCCCCCGAGTAGCTGG + Intronic
1079784499 11:24654637-24654659 CCCACCCACCCCTGAGTAGCTGG + Intronic
1080551502 11:33376697-33376719 CCCCCGCGCCCCCGCGTCGCGGG - Intergenic
1080621191 11:33988502-33988524 CCCCCCACCCCCCGGGTAGCTGG + Intergenic
1081873091 11:46391993-46392015 CCCCTGCTCCCCTGCGTCGCTGG - Intergenic
1083297450 11:61722695-61722717 CCCCCCACCCCCCGCCTCCCAGG - Intronic
1084257929 11:67955418-67955440 CCGCCCCTACCCCGCGTCCCCGG + Intergenic
1084516343 11:69639630-69639652 CCCCCCCACCCCCACCTTTCAGG - Intergenic
1084563278 11:69915819-69915841 CCTCCCCACCCCCACCTCACTGG - Intergenic
1084621009 11:70270496-70270518 CGCCCCCTCCCCCGCGACCCGGG + Intergenic
1084757686 11:71250112-71250134 CCCCCCCACCCCCGGGGAGGGGG - Intronic
1084814825 11:71639802-71639824 CCCCGGCACCCCCGCGCCCCCGG - Intergenic
1088410345 11:109526981-109527003 CCCCCCCACGCCCCTGTCTCTGG - Intergenic
1089701262 11:120245472-120245494 CCCCCACACCCCCCCTTCTCTGG - Intronic
1089738411 11:120564969-120564991 CCCCCCCACCCCCCCGCAGCCGG - Intronic
1091445362 12:541854-541876 CCCCCCCACCCCCCGGCCTCTGG + Intronic
1091450321 12:568877-568899 CCCCCCCCCCCCCGCCCCCCGGG + Intronic
1093730226 12:22558323-22558345 CCCCCCCCCCCCCGAATAGCTGG + Intergenic
1095960074 12:47828879-47828901 CCCCCCCACCCCCCGGCCCCAGG - Intronic
1096191535 12:49623356-49623378 CCCCCGCGCCGCCGCGTCCCGGG - Intronic
1096461274 12:51822329-51822351 CTCCTCCACCACCCCGTCGCCGG - Intergenic
1097879609 12:64675047-64675069 CCCCCCCCCCCCCGCCACCCCGG + Intronic
1097891393 12:64780924-64780946 CTCCCCCAGCCCCGCGCCTCCGG + Intergenic
1098321531 12:69249143-69249165 CCCCCCCCCCCCCGAGTAGCTGG - Intronic
1101819071 12:108169329-108169351 CCCCCCCACCCCCTGGTCCATGG + Intronic
1102644175 12:114393229-114393251 CCCCTCCACCCCAGCCTTGCTGG + Intronic
1102822125 12:115917106-115917128 CCACCCCAACCCCGCGGCCCGGG + Intergenic
1103269976 12:119665182-119665204 CTCCCCCACCCCCGCAACCCTGG - Intergenic
1103309019 12:119989686-119989708 CCGCCCCTCCCCCGCGCCGGCGG - Intergenic
1104841295 12:131827344-131827366 CCCCCCCCCCCCCGCTTCCCTGG - Intergenic
1104903729 12:132202751-132202773 CCGCCACACCCCAGCGTCTCTGG - Intronic
1106568467 13:30906502-30906524 CCCCGCCATGCCCGCGTCGTCGG - Exonic
1106809900 13:33349782-33349804 CCCCTCTACCCCCGAGTGGCTGG + Intronic
1108373372 13:49792372-49792394 CCCGCCCCTCCCCGCGTCGCCGG + Intronic
1108572824 13:51767774-51767796 CCCCCCCCCCCCCCCGCCCCAGG - Intergenic
1109835630 13:67852625-67852647 TCCCCCCACCCCCGAGTAACTGG - Intergenic
1110319188 13:74140939-74140961 CCCCCCACCCCCCGAGTAGCTGG - Intergenic
1110569418 13:76988585-76988607 CCCCCCTACCACCTCCTCGCTGG - Intergenic
1110704355 13:78587685-78587707 CCCCACCACCCCAGCCACGCGGG + Intergenic
1110892348 13:80707395-80707417 CCTCCCCCCCCCCGCGTTGGGGG - Intergenic
1111951723 13:94713330-94713352 TCTCCCCACTCCCGCGGCGCAGG + Intergenic
1112374875 13:98829848-98829870 CCCCCCAACCCCCACTTTGCTGG - Intronic
1112494546 13:99894729-99894751 CCCCCCCCCCCCCCCGCCTCAGG - Exonic
1113643689 13:111976615-111976637 TTCCCCCACCTCCGCCTCGCCGG - Intergenic
1113943400 13:114030029-114030051 CCACTCCACCCCCGGGACGCAGG + Intronic
1114269065 14:21090548-21090570 CCCCCCCAGCCCTGCCTCTCCGG + Exonic
1114466836 14:22929158-22929180 CCCCCTCACCCCTGCTTCTCCGG + Intronic
1114485091 14:23057439-23057461 CCCCCGCCCGCCCCCGTCGCCGG + Exonic
1114485170 14:23057655-23057677 CGCCCCCGCCCCCGCCGCGCGGG - Intergenic
1115651158 14:35403974-35403996 CCCCCCTCCCCCCGCGGCCCCGG + Intronic
1116614641 14:47119178-47119200 CCCCCCCCCCACCCCGTAGCTGG + Intronic
1116778856 14:49213232-49213254 CCACCCCACCCCCGCCCCTCAGG + Intergenic
1117690460 14:58299554-58299576 CCACCGCGCCCCCGCCTCGCTGG - Intronic
1118562289 14:67099183-67099205 CACCACAACCCCCGCCTCGCAGG + Intronic
1119341920 14:73886692-73886714 CCTCCCCAGGCCCGCGACGCAGG - Exonic
1121113911 14:91330617-91330639 CCTCCCCATCCCCTCGTCCCAGG - Intronic
1121509472 14:94501667-94501689 CCCCCCCACCCCCGCCCCAAGGG + Intronic
1121530790 14:94651715-94651737 CCCCCCCACCCCCCAGGCACAGG - Intergenic
1122647871 14:103207209-103207231 CCGCCCCTCCCCCGCGCCACAGG + Intergenic
1122959849 14:105089453-105089475 ACCCCCCACCCCGACGGCGCTGG + Intergenic
1123039354 14:105484058-105484080 CCCCGCCACCCCCGGGTCTAGGG + Intergenic
1202856947 14_GL000225v1_random:57841-57863 CCCCACCACCCCCCGGCCGCAGG + Intergenic
1202858425 14_GL000225v1_random:65178-65200 CCCCACCACCCCCCGGCCGCAGG - Intergenic
1124280603 15:28357751-28357773 GCCCCCCACCCCAGTGTCTCTGG - Intergenic
1125475968 15:40048255-40048277 CCTCCCCACCCCCGCTTCACTGG - Intergenic
1125728922 15:41882209-41882231 CACCCCCACCCCCGCCTCGCCGG + Intronic
1129036749 15:72654930-72654952 CCCCCCTACCCCGGCGCCTCTGG + Intronic
1129213138 15:74082295-74082317 CCCCCCTACCCCGGCGCCTCTGG - Intronic
1129236686 15:74227973-74227995 TCCCCCCACCCCCGCCTCCAAGG - Intergenic
1129397261 15:75258791-75258813 CCCCCCTACCCCGGCGCCTCTGG + Intronic
1129400873 15:75283068-75283090 CCCCCCTACCCCGGCGCCTCTGG + Intronic
1129730274 15:77926611-77926633 CCCCCCTACCCCGGCGCCTCTGG - Intergenic
1131117866 15:89805587-89805609 TGCTCCCACCCCCGCCTCGCCGG + Intronic
1131839012 15:96416666-96416688 CCCCCACCCGCCCGCGTCCCGGG + Intergenic
1132601723 16:775807-775829 ACCCCCAACCCCAGCGTCGTGGG - Intronic
1132934931 16:2475312-2475334 GCCCCCAACCCGCGCGTGGCCGG - Intronic
1132947055 16:2537740-2537762 CCCGCCCAGCCCCGCCCCGCAGG + Intergenic
1133102191 16:3486299-3486321 CCACCCCACCCCTGCATCGGAGG - Exonic
1134337667 16:13316185-13316207 CCCCTCCACCCTCGCTTCCCAGG - Intergenic
1135272974 16:21084961-21084983 CCCCCCCATCCCCCCGATGCAGG + Intronic
1135321867 16:21502543-21502565 CCCCCCCCCCCCCCCACCGCAGG - Intergenic
1135963344 16:27015784-27015806 CCCACCCACCCCCGCTTCAAAGG + Intergenic
1136292650 16:29285234-29285256 ACCCCCCACCCCCCCGAAGCGGG + Intergenic
1136414661 16:30095995-30096017 CGCCCCCACCCCCGCGCCCCAGG - Exonic
1136546527 16:30957990-30958012 CCCCCCCACCACCACCTCCCCGG - Intronic
1137618154 16:49858724-49858746 CCCCCACGCCCCCGCGGCCCAGG + Intergenic
1138253621 16:55530477-55530499 CCCCCCCACCCCCGCATTCCAGG - Intronic
1139465373 16:67151215-67151237 ACTCCCCACTCCCGCGTCTCTGG + Intergenic
1139664906 16:68448546-68448568 CCCCGCCTCCCTCGCGCCGCCGG + Exonic
1139965185 16:70741375-70741397 CCCCCCCACCTCCGCTGCCCCGG - Intronic
1140108797 16:71985544-71985566 CCCCGCCACCCCCAAGTAGCTGG + Intronic
1141054500 16:80803664-80803686 CCCCTCCTCCCCCGCGCCCCCGG + Intronic
1141289066 16:82700960-82700982 CCCCCCCCCCCCCCCGCCCCGGG + Intronic
1141694674 16:85613842-85613864 CCCCCACACCCCCGCTTCCTCGG - Intronic
1141781214 16:86162775-86162797 ACCCCCCACCCCCGCTTTCCTGG - Intergenic
1142235644 16:88921376-88921398 CCGCCCCACCCCAGCTTGGCAGG + Intronic
1143030631 17:3965070-3965092 CCCCCCCACCCCACCCTCTCGGG - Intergenic
1143127959 17:4656637-4656659 CCTCCCCACCCCCGCTCCGTGGG - Intergenic
1143390486 17:6556614-6556636 CACCCCACCCCCCGCGCCGCCGG + Intergenic
1143465648 17:7134424-7134446 CCCCCCCACCCCCACCCCCCAGG - Intergenic
1143483399 17:7239468-7239490 GCCCCCTCCCCCCGCGCCGCCGG + Exonic
1143576887 17:7798941-7798963 ACCCCCCACCCCCGAGTAGCTGG - Intronic
1145006254 17:19340037-19340059 CCCCCCCCCCCCGGCTTCCCGGG + Intronic
1145308106 17:21686554-21686576 CCCACCAAACCCCGGGTCGCAGG - Intergenic
1145395460 17:22490619-22490641 CCCACCCACCCCAGCCTGGCTGG - Intergenic
1145750029 17:27349146-27349168 CGCCCCCACCCTCGCGCGGCCGG + Intergenic
1145792212 17:27634441-27634463 CCCTCCCACCTCCGCCTCCCAGG - Intronic
1145998244 17:29116728-29116750 CCCCCCCCCCCCCCCCCCGCCGG + Intronic
1146022628 17:29292874-29292896 GCCGCCCCCCCCCCCGTCGCCGG - Intronic
1146703178 17:34980354-34980376 TCCCCCCACCTCCGCTTCCCGGG + Intronic
1146759114 17:35460669-35460691 CGCCCCCGCCCCCGCCCCGCTGG + Intergenic
1148323638 17:46771484-46771506 CCCCGCCGCCCCCGCGTTCCCGG - Intronic
1148755282 17:49969867-49969889 TCCCCCCACCCCCACATCCCAGG - Intronic
1148867053 17:50634313-50634335 GGCCCCCACCCCCGCCTCACGGG + Intergenic
1149094191 17:52820804-52820826 CCCCCCCACGCCCAAGTAGCTGG - Intergenic
1149488975 17:57068407-57068429 CCCCCCCACCCCCGCACCGCTGG + Intergenic
1149998151 17:61415780-61415802 CCCCCCCACCCCCAGGTCCTGGG + Intergenic
1150489224 17:65562872-65562894 CCCCCCCACCCCCGTCTCCTAGG - Intronic
1150598371 17:66627293-66627315 CCCCCCAACCCCCACGCCCCAGG - Intronic
1150643525 17:66964813-66964835 CCCCCCAACCCCGGCGCCCCCGG + Intergenic
1151293157 17:73164913-73164935 CCCCCCCAACCCCTCCTCCCGGG - Intergenic
1151854313 17:76710557-76710579 CCTCCCCACCCCCGGGGCTCCGG - Intronic
1151954390 17:77373270-77373292 CCGCCCCGCCCCCGCCTCCCGGG - Intronic
1152120368 17:78414694-78414716 CACCCCCACCCCGGCGCGGCAGG - Intronic
1152345329 17:79747671-79747693 CCTCCCCACCGCAGCGGCGCGGG + Intergenic
1152537304 17:80958203-80958225 CCCCCCCACCACCAAGTAGCTGG + Intronic
1152865836 17:82722454-82722476 CCCCCACACCCCCGCGTGTTGGG + Intronic
1152870665 17:82751649-82751671 CCCTCCCACCCACGCGTGCCCGG + Intergenic
1153051746 18:907434-907456 CCCGCCCACCCCCCCTTCGCGGG - Intronic
1153822675 18:8845551-8845573 CACCCCCACCCCCGCAGCCCTGG - Intergenic
1154207952 18:12354133-12354155 CCCCCCCCCCCCCACTTCACTGG + Intronic
1154416348 18:14177912-14177934 TCCCCCCACCCCGGCGCCGCCGG - Intergenic
1155570389 18:27185528-27185550 CCCTCCCAGCCCCGCGTGCCAGG + Intergenic
1157894490 18:51452122-51452144 CCCCTCCACCCCCAGGTCTCAGG - Intergenic
1160680106 19:408495-408517 CCCCTCCACCCCCACCCCGCCGG - Intronic
1160898584 19:1415214-1415236 CCCCTCCACCCCCACCTCACTGG - Intronic
1161396518 19:4047481-4047503 TCCCCCCACCACCCCATCGCTGG - Exonic
1161461940 19:4402826-4402848 CCCCCCCTTCCCCTCGGCGCGGG - Intronic
1161606084 19:5215644-5215666 ACCCCCCTCCCCCGAGTCCCCGG - Intronic
1162315604 19:9936475-9936497 CGCCGCCTCCCCCGCCTCGCCGG + Exonic
1162577637 19:11507990-11508012 CCCCCCCAGCCCCACATCGTAGG - Exonic
1162584716 19:11551828-11551850 CCCGCCCACCCCAGCCTCACAGG - Intronic
1162977524 19:14217174-14217196 CCCCCCCCCCCCCACATCTCTGG - Intergenic
1163027046 19:14518478-14518500 CCCGCCCGCCCCCGCGGCGCCGG + Intronic
1163138655 19:15331985-15332007 GCCCCCCACCCGCGCCCCGCCGG + Intronic
1163633732 19:18429225-18429247 GCCCCCCTCCCCCGCCTCGGAGG - Intronic
1164401099 19:27902983-27903005 CCCCCACACCCCTGCTTCTCTGG + Intergenic
1164934662 19:32201519-32201541 CCCCCCCACCCCAGCCTCCCTGG - Intergenic
1165062778 19:33212872-33212894 CCCCCCCACCACAGCCTCCCGGG - Exonic
1165350005 19:35270012-35270034 CCCCCCCACCCAGGGGTGGCAGG - Intronic
1165938881 19:39405328-39405350 CCTCCCCGCCCCCGAGTAGCGGG + Intergenic
1166100357 19:40567977-40567999 CCCCGCGACCCCCGCGGCGGCGG + Exonic
1166210347 19:41302828-41302850 CACCACCACCCCCGCGGCCCCGG - Exonic
1166382496 19:42362292-42362314 CCCACCCACCCCAGGGTCTCAGG + Intronic
1166947597 19:46406561-46406583 CCCCTCCACCCCCATGTCTCAGG + Intergenic
1167073026 19:47231354-47231376 CCCCCCTACCTCCGCGCCGGGGG + Intronic
1167271313 19:48508107-48508129 CCCCCTCACCCCAGCCACGCTGG - Intronic
1167272203 19:48511820-48511842 CCCCCCCACCCCAGCAACCCCGG - Intronic
1167320579 19:48795219-48795241 GGCCCCCAGCCCCTCGTCGCGGG - Exonic
1167466887 19:49654786-49654808 CCCCCCCACCCCCACCGGGCTGG + Exonic
1168645903 19:58059321-58059343 CCTCCCCTCCCCCTCCTCGCCGG - Intronic
1168702881 19:58451985-58452007 CTCCCCCGCCCCCCCGGCGCGGG - Intronic
925149069 2:1602220-1602242 CCTCCCCACCCACCCGACGCAGG + Intergenic
926130825 2:10302512-10302534 GCCCCCCGCCCCCACGCCGCAGG - Intergenic
927694482 2:25230784-25230806 CCCCCCCCCCCCCCCCTTGCAGG - Exonic
927713666 2:25340449-25340471 CTCCCCCAGCCCCTCATCGCTGG - Intronic
928018321 2:27680051-27680073 CCCTCCCACCCCCCAGTCACCGG - Intronic
928143610 2:28751960-28751982 TCCCCCCACCCCCTCCCCGCCGG - Exonic
928273035 2:29874238-29874260 CCACCCCACCCCCGCCACCCAGG + Intronic
928546632 2:32334933-32334955 CCGCCCCGCCCCCGAGTAGCTGG - Intergenic
929586322 2:43117099-43117121 CACCCCTACCCCCGAGTAGCTGG - Intergenic
930719760 2:54627786-54627808 CCCCCCCACCCTGGCCCCGCTGG + Intronic
931429504 2:62197082-62197104 CCACCCCACCCCCACGACTCGGG - Intronic
931869044 2:66439905-66439927 GCCCGCCACCCCCGGCTCGCGGG - Exonic
932036428 2:68251842-68251864 TCGCCCCACCCCCGCGCCGCCGG - Intronic
932893194 2:75613343-75613365 CCCCCCCCCCCCCCCCCCGCAGG - Intergenic
933654978 2:84879997-84880019 CCCCCCCACCCCCGCGTCGCGGG + Intronic
934275529 2:91570850-91570872 CCCCCCCACCCGCCCGGTGCAGG + Intergenic
934869348 2:97847062-97847084 CCCCCCCCCCCCCCAGTAGCTGG - Intronic
936600323 2:113889406-113889428 CCCCCCAACCCCCACCTCCCAGG - Intergenic
937261094 2:120587229-120587251 CCTCCCCAGCCCCGCGACGTGGG - Intergenic
937310052 2:120896441-120896463 CCCCCCCACCCCAGCTTGGTGGG - Intronic
937905634 2:127051521-127051543 CACCCCCAACCCCGCCTCACAGG + Intronic
937977959 2:127593120-127593142 CCCCCTCACTTCCGCGGCGCTGG - Intronic
939153835 2:138501833-138501855 AGCCCCCACCCCCCCGCCGCGGG - Exonic
941934812 2:170974107-170974129 CCGCCCCACCCCGGCGCCCCGGG - Intergenic
944811073 2:203328219-203328241 CCCACCCTCGCCCGCGCCGCCGG - Exonic
945234986 2:207625348-207625370 GCCGCCCGCCCCCGCGTCGCGGG - Intronic
945585239 2:211653480-211653502 CCCCCCCACGCCCGCCCCGCTGG + Intronic
946114927 2:217452978-217453000 CCCACCCACCCCCCGGTTGCTGG - Intronic
946692265 2:222318977-222318999 CACCTCCAGCCCCGCGTGGCGGG - Intergenic
946748239 2:222866763-222866785 CCCCCCCCCCCCCCCGCCCCGGG + Intronic
948139400 2:235661519-235661541 CCCCCCCACCCCCACAGCCCTGG - Intronic
948393303 2:237627502-237627524 CCCCCGCGTCCCCGCGTCCCCGG + Intergenic
948461259 2:238131017-238131039 GCCCCGCAACCCCGCGTGGCGGG - Exonic
948590924 2:239049750-239049772 CCGCCCCTCCCCAGCGTCCCAGG - Exonic
948786515 2:240355612-240355634 CCCCGCCAGCCCTGCGTCCCCGG + Intergenic
948854755 2:240724927-240724949 CCCCCCCCCCCCCCCGCCGCCGG - Intronic
948933620 2:241148971-241148993 CGCCCCCGACCCCGCGGCGCCGG + Intronic
949040160 2:241844254-241844276 CCGCCCCACCCACGCGCCCCAGG - Intergenic
1168804047 20:662485-662507 CACACACACCCCCGCGTCTCGGG - Exonic
1170443688 20:16403583-16403605 CGCCCCCACCCCCGCTTTCCAGG - Intronic
1171806971 20:29689060-29689082 CCACCCAACCCCCGGGTCCCAGG + Intergenic
1172013846 20:31861667-31861689 CCCGCCCACCCCAGCTTCGCCGG - Exonic
1172255719 20:33515560-33515582 CCCACCCACCTCAGCCTCGCTGG - Intronic
1172313606 20:33936468-33936490 CCCCCCCACCCCCACGGCTTAGG - Intergenic
1172365041 20:34342740-34342762 CACCCCCACCCCTGAGTAGCTGG + Intergenic
1172618622 20:36306197-36306219 CCCCCCCAGCCCCGCGCCCGCGG + Intergenic
1173266288 20:41485679-41485701 CCGCCCCACCCCCCAGTCCCTGG - Intronic
1173785928 20:45792621-45792643 CCACCCCACCCCAGTGTCACAGG + Intronic
1173998596 20:47358172-47358194 CCCCCCCACCCCCCCATCTCTGG + Intergenic
1174290215 20:49503035-49503057 CACCCCCACCCCTGGGTCGCTGG - Intergenic
1174296337 20:49547951-49547973 CTCCCACACCACCGCGTCGTAGG + Exonic
1174353002 20:49981723-49981745 CACCCCCACCCCAGCTTCCCTGG - Intergenic
1174576803 20:51542740-51542762 CCCCCCCCCCCCCGCCTCCCCGG - Intronic
1174862524 20:54104403-54104425 CCCCCCCACCGCCCAGTGGCTGG - Intergenic
1175268989 20:57720441-57720463 CCCCCCCACCCCCCCCCCGCGGG - Intergenic
1175816090 20:61883937-61883959 CCCCCCAACCCCCGTGTGGTGGG + Intronic
1175903039 20:62367408-62367430 CCCCCCCCACCCCGCCTCCCCGG - Intergenic
1176015169 20:62927098-62927120 CCCCCCCACCCCCACGCTCCTGG - Intronic
1176178681 20:63739919-63739941 CGCCCCCCGCCCCGCGCCGCCGG + Exonic
1176546173 21:8201210-8201232 CCCCCCCACCACCGCCTTGGTGG + Intergenic
1176565124 21:8384256-8384278 CCCCCCCACCACCGCCTTGGTGG + Intergenic
1176733308 21:10521277-10521299 CCCCTCCCCCCCCGCCCCGCCGG + Intergenic
1176856988 21:13981378-13981400 TCCCCCCACCCCGGCGCCGCCGG + Intergenic
1176867609 21:14062845-14062867 TCCCCCCACCCCGGCGCCGCCGG - Intergenic
1178077399 21:29024586-29024608 CCACCCCACCCCCACCTCCCGGG - Intergenic
1178513827 21:33229894-33229916 CGCCCCCGCCCCCGCGCCGGCGG + Intronic
1178878168 21:36428500-36428522 CCCCCCCACCCCCAAATAGCTGG + Intergenic
1179209340 21:39312935-39312957 CCCCGCCCCCCCCGCGCCGGAGG - Intronic
1179955212 21:44734658-44734680 CCCACCCACCCCCCCGTGCCGGG + Intergenic
1180131000 21:45827091-45827113 GCTCCCCACTCCCGCGTCCCTGG + Intronic
1180232627 21:46436471-46436493 CCCCCCCCCCCCCCCCCCGCTGG + Intronic
1180557042 22:16586331-16586353 CACCCCCACCCCCCCGCCGCAGG - Intergenic
1180744323 22:18077415-18077437 CGCCCCCAACCCCGCCTCGGTGG + Intergenic
1181121042 22:20668897-20668919 CACCCCCACCCCCAGGTCACTGG + Intergenic
1182299522 22:29329871-29329893 CCCCCACACCCCTGAGTCTCTGG - Intronic
1182355464 22:29720599-29720621 GCCCCCCGCCCCCGCGCCCCTGG - Intronic
1182532320 22:30969670-30969692 CCCGGCCACCCCCGCCTCCCCGG - Intergenic
1182715049 22:32351693-32351715 GCCCCCCACCCCCGCCCCGACGG - Intergenic
1182721531 22:32405043-32405065 CACCCCCACCCCAGGGTCTCTGG - Intronic
1183268923 22:36848874-36848896 GCCCCCCACCCCCCCGCCACAGG + Intergenic
1183310926 22:37109184-37109206 CCACCCTACCCCTGCCTCGCAGG - Intronic
1183516807 22:38271756-38271778 CTCTCCCACCCCAGCGTCCCAGG + Intronic
1183719837 22:39556457-39556479 CCCCCCCACCCCTCCGATGCTGG - Intergenic
1183966589 22:41446284-41446306 CCGCCCCACTCCCGCTTTGCTGG - Intronic
1184059787 22:42074655-42074677 CCTCCCCTCCCCCGCGTCTGGGG - Intronic
1184222461 22:43109934-43109956 CCTACCCATCCCCGCGTAGCAGG + Intergenic
1184680408 22:46070024-46070046 TCCCCCCAACCCCCCGCCGCCGG - Intronic
1184731056 22:46371343-46371365 CCCCCCCACCCCAGTGCCTCTGG + Intronic
1185285902 22:49999767-49999789 CCCGCCCACCTCCGCGCCCCGGG - Intronic
1185323744 22:50215620-50215642 CCCCCCCACCCCCCTGGCACAGG - Intronic
1185344414 22:50305133-50305155 CCTGCCCACGCCCGCGTCCCAGG + Intronic
1185368146 22:50446357-50446379 CCCCCCCCCCCCCCCGCCTCCGG + Exonic
1203251045 22_KI270733v1_random:117447-117469 CCCCCCCACCACCGCCTTGGTGG + Intergenic
949355796 3:3179527-3179549 CGCCCCCACGCCCGCCTCCCAGG + Intronic
949970292 3:9397832-9397854 GCCCCCCACCCCCACCTCACGGG + Exonic
950822496 3:15775913-15775935 GCCCCCCACCCCCCAGTCTCTGG - Intronic
951497669 3:23348991-23349013 CCCCCCCACCACCTCCCCGCAGG + Intronic
953319752 3:41961558-41961580 CCCCCCCCCCCCCGCTCCCCAGG + Intronic
954366894 3:50151154-50151176 CCGCCCAGCCCCAGCGTCGCTGG - Intergenic
954367596 3:50154829-50154851 CGCCCCCGCCCCCGCTTCGCGGG - Intergenic
954444498 3:50539556-50539578 CCTCCCCACCCCCGTCTCCCGGG - Intergenic
954839063 3:53495296-53495318 CTCCCCCTTCCCCGCGGCGCTGG + Intronic
955533999 3:59904077-59904099 CCCCCACACCCCCCCGCCCCCGG + Intronic
957072866 3:75579923-75579945 CCCCAGCACCCCCGCGCCCCCGG + Intergenic
958004296 3:87792781-87792803 CGCCCCCAGCCCCGGGGCGCGGG - Intergenic
958141717 3:89570914-89570936 CCCCCCCACCTCCCCGTGACTGG - Intergenic
959849526 3:111071289-111071311 CCACCCCACCCCCTCGTCCCAGG + Intronic
960097098 3:113699171-113699193 CCCCGCCTGCCCCGCGTCCCCGG + Intergenic
961873165 3:130002734-130002756 CCGCCCCTACCCCGCGTCCCCGG + Intergenic
962247274 3:133806075-133806097 CCCTCTCAGCCCCGCGTCCCCGG - Intronic
963891566 3:150641281-150641303 CCACCCCAACCCCGAGTGGCTGG - Intergenic
965003552 3:162987593-162987615 CCCCCCCACCCCCGCTCCGTGGG + Intergenic
966131988 3:176651642-176651664 CTCCCCCACCCCCCCTTCCCGGG - Intergenic
966878743 3:184338018-184338040 CCCCCCCACCACCGCCACCCTGG - Intronic
968506181 4:972474-972496 CCCTCCCACCTCAGCGTCCCTGG + Intronic
968593650 4:1471854-1471876 CCCCCACACCCCCGAGACACCGG - Intergenic
968870301 4:3238734-3238756 CCACCCCACCCCCGCCACCCAGG + Intronic
969016474 4:4107225-4107247 CCCCATCACCCCCGCGCCCCCGG + Intergenic
969737476 4:9001091-9001113 CCCCGGCACCCCCGCGTCCCCGG - Intergenic
969737484 4:9001108-9001130 CCCACCCTACCCCGCGTCCCCGG - Intergenic
971195937 4:24471831-24471853 CCCCCCCACCTCCGCGGGTCAGG + Intergenic
971352021 4:25863192-25863214 CCACCCCCCGCCCGGGTCGCTGG + Intronic
973687990 4:53393767-53393789 CCCCCCCCCCCCCCCGCCCCCGG + Intronic
974123541 4:57667857-57667879 CCCCCCCACGCCCGGGGCCCAGG + Intergenic
974716008 4:65669658-65669680 CCCCATCACCCCAGCGTCCCTGG - Exonic
976874469 4:89836919-89836941 CTCCCCCAGCCTCGCGTCGCCGG - Intronic
977696965 4:99976345-99976367 CACCCCCAACCCCGAGTAGCTGG - Intergenic
978384741 4:108168111-108168133 ACCCCGCGACCCCGCGTCGCCGG + Exonic
978659263 4:111104377-111104399 CCGCTCCACCCCCGAGTAGCTGG + Intergenic
980043664 4:127965693-127965715 CCCGCCCAGCTCCGCGTCCCCGG - Intronic
984544844 4:181089220-181089242 CCCCCCCCCCCCCGCAACTCTGG - Intergenic
984639280 4:182144587-182144609 CCTCCCCGCCCCCGCCCCGCCGG + Intronic
984823811 4:183906597-183906619 CCCCCACACCCCCACGGCGAAGG - Exonic
985782098 5:1876734-1876756 CCTCCCCATCCCCGCGGCGGAGG - Intergenic
985883708 5:2659683-2659705 CCACCCCACCCCCACCCCGCCGG + Intergenic
985928516 5:3036108-3036130 CCCTCCCACCTCCGCCTTGCAGG - Intergenic
985996599 5:3600465-3600487 CCCCACCACCACCCCGTAGCAGG - Intronic
986320965 5:6632800-6632822 CCCCCTCGCCGCCGCCTCGCAGG + Intronic
987374329 5:17219098-17219120 ACCCCCCACCCCCACCTCCCGGG + Intronic
989593600 5:43135072-43135094 CCCCCCAACCTCCGCCTCCCAGG + Intronic
990075581 5:51842927-51842949 CCCCCCCCCCCCCCCCCCGCAGG + Intergenic
990738818 5:58891685-58891707 CCGCCCCTCCCCCGTGTTGCTGG + Intergenic
991964716 5:72079519-72079541 TCCCCCCACCCCCGTGTCCCCGG - Intergenic
992549100 5:77844729-77844751 CCCCACAGCCCCCGCGCCGCTGG - Intronic
993733090 5:91445658-91445680 CCCCCCCCCCCCCGCCCTGCAGG + Intergenic
996298542 5:121954114-121954136 CCGGCCCACCCGCGCGGCGCTGG - Intergenic
997382647 5:133448724-133448746 CCCCCCCGCCCCCGCACCCCTGG - Intronic
997994900 5:138577610-138577632 GCCCCCCTCCCCCGAGTAGCTGG + Intergenic
998086291 5:139327495-139327517 CACCCCAACCCCCGCCTCCCAGG + Intronic
998166095 5:139844929-139844951 CCCTACCACCGCCCCGTCGCTGG - Intergenic
998331827 5:141334460-141334482 CCCTCCCCGCCCCGCGTAGCTGG - Intronic
998386271 5:141758776-141758798 CCTCCCCTCCCCCGCAGCGCTGG - Intergenic
998957462 5:147453050-147453072 CCCTGCCACCCTCGCGGCGCAGG + Intronic
999586450 5:153094779-153094801 CCCCCCCACCCCCGAAATGCAGG - Intergenic
999782137 5:154858186-154858208 CCCCCCCACCCCCCCGCCGTGGG - Intronic
1000220402 5:159209141-159209163 CCCCTCCCCCATCGCGTCGCAGG - Intronic
1001241934 5:170077862-170077884 CCCCCACACCCCTGCCTCCCTGG + Intronic
1001919202 5:175587306-175587328 TCCCCCCACCCCCACATCACAGG - Intergenic
1002001058 5:176196489-176196511 CCCCCCCGCCCCCACCTCCCAGG + Intergenic
1002045091 5:176537073-176537095 CCTCCCCACCCCCGGGTCCGGGG + Exonic
1002186342 5:177456487-177456509 CCACCCCGCCCCCGCCTGGCGGG + Intergenic
1002253277 5:177942483-177942505 CCCCCCCGCCCCCACCTCCCAGG - Intergenic
1003152728 6:3566230-3566252 CCCTCCCACCCCCGAGCCACAGG + Intergenic
1003163451 6:3655851-3655873 CCCCCCCACCGCCGCCCCCCCGG + Intergenic
1004321398 6:14634215-14634237 CGCCCCCACCCCCCCGACTCAGG - Intergenic
1005288997 6:24360002-24360024 CCGCCCCGCCCCCGCGCGGCCGG - Intergenic
1006472727 6:34237526-34237548 CACCCCTTCCCCCGCGCCGCGGG + Intronic
1006645340 6:35511612-35511634 CGCCCCCTCACCCGCGTCCCTGG + Intronic
1006932922 6:37698367-37698389 CCCCCCCAACCCCGCCCAGCAGG + Intronic
1007748732 6:44059002-44059024 CCCCCTCTCCCCCGCCTCCCTGG + Intergenic
1007821128 6:44561386-44561408 CGCCCCCACCCCAGCCACGCTGG + Intergenic
1009224239 6:61008159-61008181 CCCCCCCACCCCCGCATATTAGG - Intergenic
1011297697 6:85841222-85841244 CCCCCCCACCCCCACCCCACAGG - Intergenic
1013313220 6:108917245-108917267 GCCCCCTACCCCCGCTTCTCTGG + Intronic
1018627480 6:165793469-165793491 GCCCCCCAGCCCCGGGTCTCAGG - Intronic
1019337992 7:494241-494263 CCCGCCCGCCCCCGGGGCGCCGG + Intergenic
1019385704 7:754927-754949 TCCCCTCACCCCCGGGCCGCAGG + Intronic
1019512120 7:1422804-1422826 CCTCGCCACCCCCGCTTGGCAGG + Intergenic
1019524050 7:1472813-1472835 CCTCCCCACCCCCCCGTCCCTGG - Intronic
1020169418 7:5833422-5833444 ACCCCCACCCCCCGCCTCGCGGG - Intergenic
1020812641 7:12864815-12864837 CACCCCCACCCTCACGTGGCGGG - Intergenic
1021312454 7:19111077-19111099 ACCTCCCACCCCCATGTCGCTGG + Intronic
1021540698 7:21754566-21754588 CCCCCCCACCCCATCATCACAGG + Intronic
1022007369 7:26278239-26278261 CCCCCCTCCCCCCGAGTAGCTGG - Intergenic
1023810262 7:43906362-43906384 GCCCCCCACGCCCGCGCGGCCGG + Intronic
1024247192 7:47479481-47479503 CTCCCCCACCCCCCCGTCGGCGG + Intronic
1026858592 7:73770430-73770452 CCCCCCTACCCCGGCGTTGTGGG - Intergenic
1026921741 7:74160652-74160674 CCCCCCCCCCCGCGAGTAGCTGG - Intergenic
1027001606 7:74658095-74658117 GCCCCCCGCCCCCGCCTCGGGGG + Intronic
1027001664 7:74658246-74658268 CCCCACCCCCACCGCCTCGCCGG + Intronic
1027228601 7:76260043-76260065 GCCCCCCACCCCCGCCGCGGCGG - Intronic
1028983994 7:96995933-96995955 CCCCCACACCCCCGCCTTGCGGG + Intergenic
1029551195 7:101237905-101237927 CCCCCCCACCCTCGTGGGGCGGG - Intronic
1029665539 7:101992788-101992810 CCCTCCAACCCCCGCCCCGCCGG + Intronic
1030838544 7:114319147-114319169 CCCCCCCAACCCCCCATCACAGG - Intronic
1032021556 7:128409660-128409682 CCCCTCCCCCGCAGCGTCGCCGG + Intronic
1032438691 7:131924158-131924180 GCCCCCCTCCCCCGAGTAGCTGG + Intergenic
1032680037 7:134172864-134172886 GCCCCCGACCCCCGAGTAGCTGG - Intronic
1032703603 7:134403559-134403581 CCTCCCCACCCCCCAGTAGCTGG - Intergenic
1033299696 7:140175980-140176002 CCCGCACACACCCGGGTCGCCGG - Intronic
1034449497 7:151129692-151129714 CCCCCCCACCTCCCCACCGCGGG + Intronic
1034620286 7:152451663-152451685 CCCCCCCCGCCCCCCGCCGCAGG + Intergenic
1035362379 7:158322153-158322175 CCGCCCCACACCCTCGTCCCAGG + Intronic
1035449725 7:158968866-158968888 CCACCCCAGCCCCGAGTAGCTGG - Intergenic
1035455715 7:159007383-159007405 CCCGCCCTCCCCAGCGTGGCTGG - Intergenic
1036259274 8:7227798-7227820 CCCCGGCACCCCCGCGCCCCTGG + Intergenic
1036733381 8:11285079-11285101 CCGCCCCACCCCAGCTCCGCAGG + Intronic
1037371491 8:18184031-18184053 CCCCCCCACCACCCCGCCCCGGG - Intronic
1037739699 8:21598481-21598503 GCCCCCCACCCCCACCTCACCGG - Intergenic
1037880147 8:22569284-22569306 CCCACCCACCCCTCCGTCTCCGG - Intronic
1039918078 8:41874489-41874511 CCACCCCATCCCCGCCCCGCAGG + Intronic
1039996904 8:42541786-42541808 CCCCCTTACCCCCGCGTCCGGGG - Intronic
1041107582 8:54458064-54458086 CACCCCCTCCCCCGGGTCGGGGG + Exonic
1041166911 8:55101125-55101147 CCACCCCACCCCCGGCCCGCGGG - Intergenic
1043577551 8:81675249-81675271 CCCCCCCACCCCCGCCAATCTGG + Intronic
1045489096 8:102655758-102655780 CCCACCCCCGCCCGCGGCGCGGG - Exonic
1045996366 8:108366865-108366887 CCCCCCCCCCCCCGCATCTAAGG - Intronic
1046692750 8:117304216-117304238 TCCCCCCACCCCCTCACCGCCGG + Intergenic
1048980722 8:139702355-139702377 CCCACCCACCGCCCCGGCGCGGG - Intronic
1049194517 8:141308109-141308131 CCCCGCCGCCCCCGCGGCCCCGG - Intronic
1049402862 8:142438145-142438167 CCCCCCCGCCCCCGCATCCAGGG + Intergenic
1049557216 8:143289175-143289197 CTCCCCCACCCCCATGTCCCTGG + Intergenic
1049578495 8:143400386-143400408 CCCCCCCAACCCCTGGTCACCGG + Intergenic
1049682419 8:143925509-143925531 CCCCCTCAGCCCCGCCACGCTGG + Exonic
1049806380 8:144542628-144542650 CCCCCCCACCCCCACTTCGACGG + Intronic
1049988372 9:972004-972026 CCCTCCCAGCCCGGCCTCGCGGG - Intergenic
1052237681 9:26232425-26232447 CCCCACCACCCACGCCTCACTGG + Intergenic
1053253688 9:36596660-36596682 CACCCCAACCCCCGCCTCCCGGG + Intronic
1054160326 9:61668517-61668539 CCCCCCAACCCCCGGGTCCCAGG - Intergenic
1054160780 9:61670948-61670970 CCCCCCACCCCCCGGGTCCCAGG - Intergenic
1054172954 9:61857193-61857215 GCCCCCCACCCCCGGGTCCCAGG + Intergenic
1054664588 9:67723588-67723610 GCCCCCCACCCCCGGGTCCCAGG - Intergenic
1056643410 9:88388993-88389015 CCCCGCCCCGCCCCCGTCGCCGG - Intronic
1056917793 9:90760243-90760265 CCCCCCCCCCCCCCCATCGCAGG + Intergenic
1057227767 9:93301584-93301606 CCCCCCCACCCCTGCGTCTCTGG + Intronic
1057523979 9:95783671-95783693 CGCCCCCACCTCCCCGTCACAGG - Intergenic
1057596573 9:96419342-96419364 CCGCCCCAGCCCCGCCTGGCTGG + Intergenic
1058005145 9:99906584-99906606 CGCCCCCGCCCCCGCCCCGCAGG - Intergenic
1059123437 9:111662011-111662033 CCTCCCGGCCCGCGCGTCGCCGG - Intronic
1059176649 9:112174904-112174926 CCCGCCCGACCCCGCGACGCCGG - Intronic
1059405824 9:114098070-114098092 CCCACCCAGCCCCGCCCCGCGGG + Intronic
1060228990 9:121813424-121813446 ACCCCCCAACCCCCCGCCGCTGG + Intergenic
1060477929 9:123999621-123999643 CCCCGCGTCCCCCGCGTCCCCGG - Intergenic
1060744794 9:126124206-126124228 CCCCCCCCCCCCCCCGCCCCAGG + Intergenic
1061033410 9:128100330-128100352 CCCCCCCGCCCCCGCCTCCCAGG - Intronic
1061237602 9:129351711-129351733 CCCCCCCGCCCCCGCCTTGGTGG + Intergenic
1061808396 9:133148928-133148950 CGTCCCCAGCCTCGCGTCGCGGG - Intronic
1061987181 9:134136426-134136448 CGCCCCCACCTCCGCCTCCCCGG + Intronic
1062558822 9:137130076-137130098 CAGCCCCATCCCCGCGCCGCGGG - Intergenic
1062628756 9:137454361-137454383 CCCCCCCACCCCCGCCGCACGGG + Intronic
1062660331 9:137627822-137627844 CCCCCCCACCCCCAAGTAGCTGG + Intronic
1203467450 Un_GL000220v1:100714-100736 CCCCCCCACCACCGCCTTGGTGG + Intergenic
1185476601 X:419307-419329 ACCCCCCACCGCCGCCTCCCCGG + Intergenic
1185738674 X:2512853-2512875 CACCCCCACCCCCAAGTAGCTGG - Intergenic
1186852339 X:13592854-13592876 CCCCCCCACCCCCCCGACAAAGG - Intronic
1189318896 X:40075309-40075331 ACCCCCCACCCCCGCCCCGCCGG - Intronic
1189391607 X:40581142-40581164 ACCCCCAAGCCCCGCGGCGCAGG - Intronic
1189800565 X:44688475-44688497 ACCCCCCACCCCCACCACGCCGG - Intergenic
1190133066 X:47768770-47768792 CCCCCCCACCCCCACCTGCCCGG + Intergenic
1190329431 X:49226579-49226601 CACCCCCACCCCAGCCTGGCTGG + Intronic
1190827951 X:54034882-54034904 GCCCCCCACCCCCCAGTAGCTGG - Intronic
1192185129 X:68941592-68941614 CCACCCCACCCCCGCCCTGCAGG + Intergenic
1195256332 X:103094349-103094371 CACCCCCACCCCCGCCTCCGTGG + Intergenic
1198462703 X:136878628-136878650 CCCCCCCCCCCCCCAGTAGCTGG - Intronic
1199787429 X:151117569-151117591 CCCCCTCATCCCCGCTTCGGGGG + Intergenic