ID: 933655202

View in Genome Browser
Species Human (GRCh38)
Location 2:84881115-84881137
Sequence CCGGGGCCGCGGGGCGCCTC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 371
Summary {0: 1, 1: 0, 2: 3, 3: 32, 4: 335}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933655183_933655202 30 Left 933655183 2:84881062-84881084 CCCGGAACGCGGAGGGAAGGAGT 0: 1
1: 0
2: 0
3: 9
4: 139
Right 933655202 2:84881115-84881137 CCGGGGCCGCGGGGCGCCTCCGG 0: 1
1: 0
2: 3
3: 32
4: 335
933655192_933655202 -6 Left 933655192 2:84881098-84881120 CCGCCCGCCCTGGCTAGCCGGGG 0: 1
1: 0
2: 0
3: 19
4: 164
Right 933655202 2:84881115-84881137 CCGGGGCCGCGGGGCGCCTCCGG 0: 1
1: 0
2: 3
3: 32
4: 335
933655184_933655202 29 Left 933655184 2:84881063-84881085 CCGGAACGCGGAGGGAAGGAGTA 0: 1
1: 0
2: 1
3: 6
4: 92
Right 933655202 2:84881115-84881137 CCGGGGCCGCGGGGCGCCTCCGG 0: 1
1: 0
2: 3
3: 32
4: 335
933655194_933655202 -9 Left 933655194 2:84881101-84881123 CCCGCCCTGGCTAGCCGGGGCCG 0: 1
1: 0
2: 0
3: 22
4: 200
Right 933655202 2:84881115-84881137 CCGGGGCCGCGGGGCGCCTCCGG 0: 1
1: 0
2: 3
3: 32
4: 335
933655195_933655202 -10 Left 933655195 2:84881102-84881124 CCGCCCTGGCTAGCCGGGGCCGC 0: 1
1: 0
2: 0
3: 18
4: 162
Right 933655202 2:84881115-84881137 CCGGGGCCGCGGGGCGCCTCCGG 0: 1
1: 0
2: 3
3: 32
4: 335

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933655202 Original CRISPR CCGGGGCCGCGGGGCGCCTC CGG Exonic