ID: 933655202

View in Genome Browser
Species Human (GRCh38)
Location 2:84881115-84881137
Sequence CCGGGGCCGCGGGGCGCCTC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 371
Summary {0: 1, 1: 0, 2: 3, 3: 32, 4: 335}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933655184_933655202 29 Left 933655184 2:84881063-84881085 CCGGAACGCGGAGGGAAGGAGTA 0: 1
1: 0
2: 1
3: 6
4: 92
Right 933655202 2:84881115-84881137 CCGGGGCCGCGGGGCGCCTCCGG 0: 1
1: 0
2: 3
3: 32
4: 335
933655183_933655202 30 Left 933655183 2:84881062-84881084 CCCGGAACGCGGAGGGAAGGAGT 0: 1
1: 0
2: 0
3: 9
4: 139
Right 933655202 2:84881115-84881137 CCGGGGCCGCGGGGCGCCTCCGG 0: 1
1: 0
2: 3
3: 32
4: 335
933655194_933655202 -9 Left 933655194 2:84881101-84881123 CCCGCCCTGGCTAGCCGGGGCCG 0: 1
1: 0
2: 0
3: 22
4: 200
Right 933655202 2:84881115-84881137 CCGGGGCCGCGGGGCGCCTCCGG 0: 1
1: 0
2: 3
3: 32
4: 335
933655195_933655202 -10 Left 933655195 2:84881102-84881124 CCGCCCTGGCTAGCCGGGGCCGC 0: 1
1: 0
2: 0
3: 18
4: 162
Right 933655202 2:84881115-84881137 CCGGGGCCGCGGGGCGCCTCCGG 0: 1
1: 0
2: 3
3: 32
4: 335
933655192_933655202 -6 Left 933655192 2:84881098-84881120 CCGCCCGCCCTGGCTAGCCGGGG 0: 1
1: 0
2: 0
3: 19
4: 164
Right 933655202 2:84881115-84881137 CCGGGGCCGCGGGGCGCCTCCGG 0: 1
1: 0
2: 3
3: 32
4: 335

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933655202 Original CRISPR CCGGGGCCGCGGGGCGCCTC CGG Exonic
900091845 1:924148-924170 CCAGGGCCTCGGGGCTCCCCGGG - Intergenic
900114850 1:1024064-1024086 CAGGGGCCAAGGGGAGCCTCAGG + Intronic
900134124 1:1107028-1107050 GCGGGGGTGCGGGGGGCCTCGGG - Intronic
900568896 1:3348752-3348774 CCGGGGCCGCAGTGAGCCTGGGG + Intronic
900605617 1:3522378-3522400 CTGGGACCTCGGGGCCCCTCTGG - Intronic
901234775 1:7661881-7661903 CCGGGGCAGGCGGGCGCCACGGG + Intronic
901303682 1:8217359-8217381 CCAGGGCCGGAGGGCGCCGCAGG + Intergenic
902920777 1:19665113-19665135 CCGGGGCCGCCAGGCCCCGCGGG - Intergenic
903466254 1:23554526-23554548 CCAGGCCCGCTGGGCTCCTCCGG - Intergenic
905653555 1:39671992-39672014 CCGGGCTCGCGGGGCTCCTGGGG + Exonic
906637155 1:47417129-47417151 CCGGGGCCGGGGCGCGTCGCGGG - Exonic
911219719 1:95234120-95234142 GCGGAGGCGCGGGGCGCCCCCGG + Intronic
912305251 1:108560293-108560315 GCGCGGCCGGGGGGCGCCGCAGG - Exonic
912381365 1:109249769-109249791 CGGGGGCCCCGCGGCGCCCCTGG - Intergenic
912492622 1:110070473-110070495 CGCGGGCCGCGGGGCGGCGCGGG + Exonic
913161831 1:116152195-116152217 TCGGGGCCGCGAGGAGCCGCGGG - Intergenic
913963147 1:143354325-143354347 CCGGGGACTCCGGGCACCTCGGG - Intergenic
914057503 1:144179911-144179933 CCGGGGACTCCGGGCACCTCGGG - Intergenic
914121643 1:144786455-144786477 CCGGGGACTCCGGGCACCTCGGG + Intergenic
915127988 1:153679112-153679134 CCGGGGCCCCGGCGCCCCGCTGG + Exonic
921604029 1:217135763-217135785 GTCGGGCCGCTGGGCGCCTCCGG + Intronic
922526495 1:226308682-226308704 CCGGGGCCGGGGGAGGGCTCGGG - Intronic
922586328 1:226737241-226737263 CCGGGGCTCCGGGGCTCCTCGGG + Exonic
923007917 1:230067076-230067098 CTGGTGCCGCGCGGCGCCGCCGG + Intronic
923611999 1:235504193-235504215 TCGGGGCCGCGCTGCACCTCTGG - Exonic
924613176 1:245590295-245590317 CCGGGGCGGCTGGGCCCCGCGGG + Intronic
1063114488 10:3064230-3064252 CAGGGGCCACGGGGAGCCACTGG - Intergenic
1063393667 10:5666561-5666583 CGGCGGCCGCGCGGCGACTCTGG + Exonic
1063660965 10:8034901-8034923 GCGCGGCCGGGCGGCGCCTCGGG + Intergenic
1064208913 10:13347616-13347638 CTGGGGTCGCGGGGTGCCTCCGG - Intronic
1066126593 10:32347650-32347672 ACGGCGGCGCGCGGCGCCTCTGG - Intronic
1067227894 10:44387079-44387101 CTGGGGCCTCAGGGCGCCTGCGG - Intergenic
1071527491 10:86366736-86366758 CCGGGCCGGCGTGGCGGCTCTGG + Intergenic
1074591853 10:114821673-114821695 GCGGGGCCGCTAGGCGCCGCGGG - Intergenic
1074815255 10:117137589-117137611 CCCGGTCAGCGGGGCCCCTCCGG + Intronic
1074864518 10:117537114-117537136 CCGGGGCAGCCTGGCTCCTCCGG - Intergenic
1075375501 10:121975102-121975124 CCGGGGCCGCGACCCGCATCGGG - Exonic
1075501731 10:122980716-122980738 CCTGGGCCGCGGGGCGGGGCGGG + Intronic
1075631081 10:124001043-124001065 CCTGGCCCGCGGGGCGACTGGGG + Intergenic
1075693642 10:124418428-124418450 CCGGAACCCCGGGGCGCCTCGGG + Intronic
1075697775 10:124448885-124448907 CCTGGGGCCCGGGGCGCCTCTGG - Intronic
1075999838 10:126905724-126905746 CCGGGGGCGCGGGGCGGCCGGGG - Intronic
1076865750 10:133165456-133165478 GCGGGGCCCTGGGGTGCCTCTGG - Intronic
1076878843 10:133230374-133230396 CGGGGTCCCCGGGGCGTCTCCGG - Exonic
1076898469 10:133325607-133325629 CGGGGTCCGCGGGGAGCCCCTGG - Intronic
1077053133 11:576633-576655 TCCGGGCCGCGGGCCGCCTGTGG + Intronic
1077205024 11:1337764-1337786 CAGGGCCTGGGGGGCGCCTCCGG + Intergenic
1077386100 11:2270245-2270267 CCGGGGACGCGGGTCTCCGCCGG + Exonic
1078771779 11:14358651-14358673 CCGGGCCCGCGAGGCGCCTCTGG + Intronic
1080802049 11:35618494-35618516 TCGCGGCCGCGGGGCGCTGCGGG - Exonic
1081831504 11:46119963-46119985 CGGCGGCCGCGGGGCGCCCCCGG - Intronic
1083592768 11:63904982-63905004 CAGGGCCGGCGGGGGGCCTCTGG + Exonic
1083618075 11:64036126-64036148 CCGGGGAGGCGGGTCTCCTCGGG - Intronic
1083670939 11:64299673-64299695 CCGGGGCCGCGGGGCCGCACGGG - Exonic
1083728884 11:64642749-64642771 CCAGGGCCGGGGGGCGGCGCGGG + Intronic
1083772830 11:64878021-64878043 CAGGGGGCGGGGGGCGCGTCCGG - Intronic
1083901773 11:65646799-65646821 CCCGGGGCGCGGGTCGCCGCCGG + Exonic
1084153880 11:67303445-67303467 CCGGGCCCGCGGAGCTTCTCAGG - Exonic
1084204512 11:67584010-67584032 CAGGGGGCCCGGAGCGCCTCGGG + Intronic
1084653095 11:70500418-70500440 CCAGGGCGGCAGGGCTCCTCGGG + Intronic
1084672013 11:70612625-70612647 CGGGGGCCGCTGGGGGCTTCTGG - Intronic
1084888488 11:72225006-72225028 CCGGGCCCGGGGGGCGCCCTGGG + Exonic
1084973049 11:72781736-72781758 CCGGGGCCGCGCGGGGGCTCTGG + Intronic
1085266023 11:75238616-75238638 CAGGGGCCTTGGGGCCCCTCTGG + Intergenic
1085666172 11:78417522-78417544 CCGGAGCCGCGGGGGGCCGGGGG - Intronic
1087713685 11:101583304-101583326 CCGGCGACGCGGGGCGGATCGGG - Intronic
1089687707 11:120167528-120167550 CCGGGGCAGAGGGAAGCCTCCGG + Intronic
1091219157 11:133920240-133920262 CTGGGGCCGCCGTGCGCCCCCGG + Exonic
1094843230 12:34350609-34350631 CCGGAGCCGCTGGGCCCCGCAGG - Intergenic
1096389390 12:51217454-51217476 CCGGGGCGGCGGGGAGCTGCGGG - Intronic
1096627257 12:52903574-52903596 CCGGGGGCCCGGGGCCCCTCAGG + Intronic
1096773758 12:53951987-53952009 CCGGGGCCGGCGGGAGGCTCGGG - Intergenic
1097787789 12:63780070-63780092 CCGGGTCCCCGCGGGGCCTCAGG + Exonic
1100539977 12:95548668-95548690 CCGGGGCCGGGAGGCACCTGGGG - Intronic
1101371711 12:104137564-104137586 CCGGGGCGGCCGGGCGAGTCAGG - Intronic
1101482161 12:105108168-105108190 CCGGGGCCGCTGGGCCTCCCGGG - Intronic
1101641313 12:106587244-106587266 CAGGGGCCGCCCGGCGCCTCGGG + Intronic
1101762476 12:107670140-107670162 CCAGGACAGCCGGGCGCCTCTGG + Intergenic
1102068619 12:109999503-109999525 CCGGGGTCGCCGGCCGGCTCAGG - Exonic
1103488325 12:121297185-121297207 CCGGGGCTGCAGGGCGCCTCCGG + Intronic
1103691081 12:122774721-122774743 CGGGCGCGGCGGGGCGCCGCGGG + Intronic
1104761328 12:131299018-131299040 CCGGGGCCGAGGGCCGCGTGGGG + Intergenic
1104818447 12:131661774-131661796 CCGGGGCCGAGGGCCGCGTGGGG - Intergenic
1104854285 12:131894846-131894868 CCGGGGCCGCGCGCCCCATCGGG - Exonic
1104854652 12:131896026-131896048 TCTGGGCCGCAGGGCGCCCCAGG + Intronic
1104926760 12:132317818-132317840 CAGGGGCTGCTGGGAGCCTCAGG + Intronic
1104929221 12:132329410-132329432 CTGGGGTCGCGGGGCGCGGCCGG + Intergenic
1105557364 13:21459419-21459441 CGCGGGCCGCGGGCCGCCCCCGG + Intergenic
1107058437 13:36131017-36131039 CCGCAGCCGCGGGGCGCCGAGGG - Intronic
1109915885 13:68984784-68984806 CCTGGGCCGCGTGTCGCCCCTGG - Intergenic
1111935019 13:94549332-94549354 ACGGGGCCGCGCGCCGCCTGGGG - Intergenic
1112415579 13:99201006-99201028 CTGGGGCAGCGGGGACCCTCGGG + Intronic
1113424974 13:110200350-110200372 CCTGGACCCCGGGGCTCCTCAGG - Intronic
1113757057 13:112819850-112819872 CGGGGGCCGCTGGGCGCGTCCGG + Intronic
1113847225 13:113399312-113399334 CCTGGGCCGCGGGGGGCCAAAGG - Intergenic
1115819393 14:37197914-37197936 ACGGGGCGGCGGCGCGCCGCAGG - Intronic
1118285260 14:64465373-64465395 CCGGAGGCGCGGGGCGGCGCGGG - Intronic
1118767589 14:68920594-68920616 CCAGGGCCCCGGGGAGTCTCGGG + Intronic
1120787963 14:88554551-88554573 CCGGGGCCGCGGGCGCGCTCCGG + Intronic
1121226043 14:92322814-92322836 GCGGGGCCTCGGGTCGGCTCGGG + Intronic
1121437080 14:93927288-93927310 CCGGAGCTGGGGGGCCCCTCAGG - Intronic
1122162201 14:99793067-99793089 CAGGGGCTGCGGGGCGCGGCGGG - Intronic
1122221197 14:100239931-100239953 CCGGGGCCGGGGCGCGCGGCCGG - Intronic
1122779741 14:104138621-104138643 CCGGGCCATGGGGGCGCCTCGGG + Intergenic
1122779982 14:104139483-104139505 CCGAGGCAGCAGGGCCCCTCGGG - Intronic
1123024896 14:105419934-105419956 GCGGGGGCGGGGGGCGCCGCAGG - Exonic
1123735820 15:23181206-23181228 TGGGTGCCGGGGGGCGCCTCTGG + Intergenic
1124286534 15:28404189-28404211 TGGGTGCCGGGGGGCGCCTCTGG + Intergenic
1124296169 15:28507447-28507469 TGGGTGCCGGGGGGCGCCTCTGG - Intergenic
1124340395 15:28886333-28886355 CCGGGTCCTCGCGGCGCCCCGGG - Intronic
1124754125 15:32393741-32393763 CCAGGGCCTCTGGCCGCCTCTGG + Intronic
1124778014 15:32602993-32603015 CCAGGGCCTCTGGCCGCCTCTGG - Intronic
1124966696 15:34437321-34437343 CCGGGTCCCCGCGGCGCCGCGGG + Intronic
1125589144 15:40843927-40843949 GCGGGGCCGCGGGGCGGGCCGGG + Intergenic
1126436638 15:48644841-48644863 CCGGCGGCGCGGTGCGCTTCAGG - Exonic
1127753577 15:62068455-62068477 TCGGGGCCCGGGGGCGCCTCCGG - Exonic
1128161034 15:65422951-65422973 CCGGGGAGGCGCGGCGCCGCGGG + Exonic
1130224160 15:82045252-82045274 CCAGGGCAGCGGCGCGGCTCCGG + Intronic
1131097482 15:89665746-89665768 CCCGGGCCGGGGGGCGCGCCGGG + Exonic
1132251958 15:100341264-100341286 CCGGGCGCGCGGGGCGGCTGGGG + Exonic
1132314338 15:100879545-100879567 CCGGGGCCCGGCGGCTCCTCGGG + Exonic
1132348326 15:101121789-101121811 GCCGGGCCGTGGGGCGTCTCGGG - Intergenic
1132522213 16:397102-397124 CCGGGGCGGCGGGGGGCTCCGGG + Intronic
1132522222 16:397120-397142 CCGGGGCGGCGGGGGGCTCCCGG + Intronic
1132672045 16:1106028-1106050 CTGGGGCCGTGGGGGGCCTCGGG + Intergenic
1132683873 16:1154224-1154246 GGGGGGCCACCGGGCGCCTCCGG + Intronic
1132761188 16:1509340-1509362 CTGGGGCCCCGGGGAGCCTTGGG - Intronic
1132845967 16:2001036-2001058 CGGGGGCCACGGGGATCCTCAGG + Exonic
1132883786 16:2173591-2173613 CCGGGGCCGCCGGCCTCCCCGGG - Intronic
1132889331 16:2196309-2196331 CCGGGGGCGCGGGGCGCGGGTGG - Intronic
1133029689 16:3004475-3004497 CCGGGGCCCCAGGGCGCCAGCGG - Intergenic
1133029693 16:3004486-3004508 CTGGGGCCCCGGCGCGCATCTGG + Intergenic
1134134110 16:11668487-11668509 CCGGGCCCGCGGGGCTGCTGCGG + Exonic
1134849810 16:17470656-17470678 CCGGGGCCGGGGAGCGCCGCGGG - Exonic
1135040772 16:19115114-19115136 CGGGGGCCTCGGGGGGCCACTGG + Exonic
1135342895 16:21664156-21664178 GCGGGGCCGCGGGGCTCATGCGG - Intergenic
1136237823 16:28925327-28925349 CCGGGGCCGGGGGCCGACTCGGG - Exonic
1137426328 16:48384702-48384724 CCCGGGCCTCCGGGCGCCGCGGG + Intronic
1137426659 16:48385733-48385755 CCGGGGCCGCGTGACCCCCCCGG + Intronic
1137670210 16:50274260-50274282 CGGGGGCCACGGGGCTCCTGTGG + Intronic
1138572424 16:57884340-57884362 CCGGGGGCTCGGGGGGCGTCCGG + Exonic
1139631888 16:68236202-68236224 CCCGCCCCGCGGGGCGCCACGGG - Exonic
1140223009 16:73057945-73057967 CCGGGGCCCCGGCGCCTCTCGGG + Intronic
1141079275 16:81036212-81036234 CCCGGGCCGCCGGCCGCGTCGGG - Intronic
1142156179 16:88533801-88533823 GCCGGGCCGGGGGGCGCCTTGGG - Exonic
1142163346 16:88570661-88570683 CCGGGAGCCCGGCGCGCCTCCGG + Intronic
1142188433 16:88706031-88706053 CCGGGGCCTCGGGGCGCGTGGGG - Intronic
1142245187 16:88967120-88967142 TCGGGGCCGAGTGGCACCTCGGG - Intronic
1142245205 16:88967173-88967195 TCGGGGCCGAGTGGCACCTCGGG - Intronic
1142245224 16:88967227-88967249 TCGGGGCCGAGTGGCACCTCGGG - Intronic
1142376801 16:89710803-89710825 CTGGGGCCGCGGGGCTGCGCTGG + Exonic
1142848081 17:2691732-2691754 CCGGGGCGGAGCGGCCCCTCCGG - Intronic
1143106647 17:4533597-4533619 CCAGGGCCTCTGGGTGCCTCAGG + Intronic
1143564412 17:7712730-7712752 GCGGGGCTGCGGGGAGTCTCTGG - Intergenic
1143845950 17:9772725-9772747 CTGGGGCCCCTGGGGGCCTCGGG - Intronic
1144656855 17:17042487-17042509 CAGCGGCCGCGGGGCGCCGAGGG + Intergenic
1144756487 17:17682848-17682870 GCGGGGGCGCGGCGGGCCTCGGG + Intronic
1144758642 17:17694816-17694838 GCGGGGCCGCGGGGCGGGGCGGG + Intronic
1144942781 17:18952871-18952893 CAGGGGCAGCGGGGCCCCTGGGG + Intronic
1144944259 17:18961736-18961758 CCGGGGCCCCGTGGGGGCTCTGG - Intronic
1146022606 17:29292836-29292858 CCGGGGCCGCGCGCCGCCACCGG + Intronic
1146058719 17:29593584-29593606 CCGGGGCCGCGGCGCCCGGCCGG - Exonic
1146492516 17:33292678-33292700 CAGGAGCCGCGGTGCGCCTCTGG - Exonic
1147392886 17:40121511-40121533 GCGGGGCCGCGGGGCCCCTCCGG + Intergenic
1147539727 17:41347008-41347030 CCGGGGCCCTGGGGGGCCTCGGG + Intronic
1147541676 17:41365339-41365361 CCGGGGCCCTGGGGGGCCTCGGG + Intronic
1147543354 17:41379517-41379539 CCAGGGCCCTGGGGCACCTCGGG + Intronic
1147545150 17:41395409-41395431 CCGGGGCCCTGGGGGGCCTTGGG + Intronic
1148126785 17:45241456-45241478 CCAGGGCCGAGGGCCGCGTCGGG - Exonic
1148558398 17:48592180-48592202 CTTGGGCCGCTGGGCTCCTCTGG + Exonic
1150060505 17:62065110-62065132 CCGGGGCCGGCGGGCGCCGAGGG - Intronic
1150236998 17:63601200-63601222 CCGGGGCTGCGGTGCCGCTCCGG + Exonic
1151370792 17:73645055-73645077 CCGGGGACGCGGCGCCCCTTCGG + Intergenic
1151946382 17:77322077-77322099 CAGGGGCCTCGGGGAGCCTCGGG + Intronic
1152320867 17:79608373-79608395 CGGGGACCTCGGGTCGCCTCTGG - Intergenic
1152544070 17:80992050-80992072 CCGAGGGCGCGGGGCTCTTCCGG - Intronic
1152581176 17:81166191-81166213 CTGGCGCCGCGGGGCTCCGCTGG + Intergenic
1152640270 17:81446429-81446451 CCGGGGCTGGGGGTGGCCTCAGG - Intronic
1152747890 17:82049599-82049621 CCGGGGCAGTGGGGCCCCTGGGG + Intronic
1153070409 18:1098497-1098519 CCGGGGGCGGGGGGAGGCTCAGG - Intergenic
1154250118 18:12737391-12737413 CATGGGCCGCAGGGGGCCTCTGG + Intergenic
1156171748 18:34494000-34494022 CCGGGGGCGCGGGGCCGCGCAGG + Intronic
1157492958 18:48136825-48136847 GGGTGGCCGCGGGGCGGCTCTGG - Intronic
1158833784 18:61308833-61308855 CCAGGGCCCCGGGGCTCCTGTGG + Intergenic
1160165380 18:76506823-76506845 CCGGGGGAGAGGGGCGCCTAGGG + Intergenic
1160242298 18:77132599-77132621 CCGAGGCCGAGGGGCGCCGCGGG + Exonic
1160499730 18:79395794-79395816 CCGGGCCCGCGCGGGGCCCCGGG - Intergenic
1160540461 18:79617637-79617659 CAGGGGTCGCGGGGCGCTTGTGG - Intergenic
1160613789 18:80109151-80109173 CAGGGGCCCCGGGGGGCCTGTGG + Exonic
1160631058 18:80246879-80246901 TCGGGGCCGTGGGGGGGCTCTGG - Intronic
1160822594 19:1065439-1065461 GCGGGGCCGCGGGGAGGCCCTGG + Exonic
1160849487 19:1183546-1183568 CCGGGGCGGTGGGGAGCCACGGG + Intronic
1160858709 19:1228705-1228727 CGGGGGCCGCGGGGCGCTAACGG - Exonic
1160869313 19:1269739-1269761 GCGGGGCCACGTGGCGCCCCCGG + Intronic
1161006854 19:1941380-1941402 CCGGGCCCGCGGGCAGCGTCTGG - Exonic
1161313215 19:3606458-3606480 CCCGGGCTGCTGGGCGCATCCGG - Intronic
1161350618 19:3789435-3789457 CCGGAGCCCTGGGGCTCCTCGGG - Intronic
1161586195 19:5107132-5107154 CCGGGGAAGCTGGGCGCATCTGG - Intronic
1161925293 19:7294628-7294650 TCGGGCCTGTGGGGCGCCTCCGG - Intergenic
1162953534 19:14085743-14085765 CCGGCGCGGCGGCGCGGCTCCGG - Exonic
1163442440 19:17328725-17328747 CGGGGGCTGCGGGGCGCCGGAGG - Exonic
1163577262 19:18118077-18118099 CCGGCTCCGCGGGGCTCCTGGGG + Intronic
1165274261 19:34734333-34734355 CCAGCGACGCGGGGCGCCTGCGG + Intronic
1166211008 19:41306576-41306598 CAGGGGCCTCCGGGAGCCTCTGG - Exonic
1167501562 19:49851360-49851382 CCGGCGCCGGGGGCCCCCTCGGG + Exonic
1167578470 19:50328898-50328920 CCGGGCCCGCGGGGTGCCGGGGG + Exonic
1167605615 19:50480149-50480171 CCAGGGCCCCGGGTCGCCTTGGG - Exonic
1168694468 19:58396772-58396794 CTGGGGCCGCGGGGGGCCGGAGG - Exonic
1202696987 1_KI270712v1_random:132584-132606 CCGGGGACTCCGGGCACCTCGGG - Intergenic
925610253 2:5696365-5696387 CAGGGGGCGCGGGGCGCGGCGGG + Exonic
929313597 2:40452245-40452267 CCGCGGCTGCCGGGCGCCCCGGG + Intronic
929452753 2:42047966-42047988 GCGGGGGCGGGGGGCGGCTCTGG + Intergenic
931348866 2:61470922-61470944 CCGGCGCCTCGGCGCCCCTCCGG - Intergenic
931762615 2:65431344-65431366 CACGCGCCGCGGGGCCCCTCGGG + Intronic
933655202 2:84881115-84881137 CCGGGGCCGCGGGGCGCCTCCGG + Exonic
935196683 2:100820381-100820403 CCGGCCCCGCGGGGCCGCTCCGG + Exonic
935645318 2:105329644-105329666 CCCAGGCCGCGGGGCGGCGCGGG - Exonic
936104474 2:109613630-109613652 CCGCGGCGGCCGGGCGCCTGGGG - Intronic
937083807 2:119157989-119158011 CCAGGGCCGCGGGGGCCCCCTGG - Exonic
937895129 2:126972261-126972283 CCGGGGCCAGGGGCCGGCTCCGG - Intergenic
938273104 2:129992811-129992833 CCGGGGGCGAGGGGCAGCTCGGG + Intergenic
938443120 2:131353295-131353317 CCGGGGGCGAGGGGCAGCTCGGG - Intronic
938467458 2:131532896-131532918 CCGGGGCTGCCTGGGGCCTCTGG - Exonic
941008367 2:160270326-160270348 ACGTGGCCGCGGGGCCCCCCGGG - Intronic
944675784 2:202033707-202033729 CCGGGGCCTGGGGCCGCCCCCGG + Intergenic
946329685 2:219002176-219002198 CTGGGGACCCTGGGCGCCTCTGG + Intergenic
946416915 2:219544297-219544319 CCGGGGTTGCGGGGCGCCAGAGG - Exonic
946434319 2:219641802-219641824 CCTGGGCTGGGGGGCTCCTCAGG + Exonic
948213877 2:236214727-236214749 CCTGGGCCGCGGGGCGCACGTGG - Exonic
948933661 2:241149102-241149124 CCCGCGCCTCGGGTCGCCTCGGG - Intronic
949080002 2:242088925-242088947 CCGGGGGCGGCGGGCGCGTCAGG + Intergenic
1168757217 20:325891-325913 CCGGGGCCGCTAGACGCCGCCGG - Exonic
1168771873 20:420835-420857 GCGGGGCCACGGGGCGGGTCAGG - Intronic
1169382398 20:5119559-5119581 CCGGGGCCGCGAGGCTCACCTGG + Exonic
1172474399 20:35226542-35226564 CAGGGGCCGCGGAGCGGCGCTGG - Intergenic
1172966001 20:38835850-38835872 CCAGGGCAGCGCGGGGCCTCTGG - Exonic
1173250579 20:41362323-41362345 CCGGGGCACCGGGGCCCCTTTGG + Exonic
1173831108 20:46089378-46089400 CCGGTGCCACGGGACGCCTTGGG + Intronic
1174204412 20:48828237-48828259 CCGGCTCCGCGGGGCCCTTCCGG - Intergenic
1174475963 20:50795517-50795539 CCCGGGCCGAGCGGCGCCTCAGG + Intronic
1174607030 20:51768450-51768472 CCGGGGCGGCGCGGCGCCGGCGG - Exonic
1175424645 20:58855673-58855695 CCGGGGCCCCGGGACTCCCCTGG + Intronic
1175517247 20:59577461-59577483 CCGGGGCCGCGGGGAGGCGCCGG - Intergenic
1175715858 20:61253542-61253564 CCGAGGCCGCGGGGCGCTGGGGG + Intronic
1176029834 20:63006605-63006627 CCGTAGCCGCGGGCCGCTTCGGG + Exonic
1176077304 20:63254308-63254330 CCGGGGCGGAGGGACGCTTCGGG + Intronic
1179290388 21:40013243-40013265 CCAGGACCGTGGGGCGCTTCAGG + Exonic
1179605632 21:42513788-42513810 CCTGGCCCGCGGGGCGCCGGCGG - Intronic
1180093009 21:45542310-45542332 CGGGGGCTGCGGGGTGTCTCGGG - Intronic
1180158080 21:45987625-45987647 CCGGGGCTCCGGGGCGACCCCGG + Exonic
1180181520 21:46120527-46120549 GCCAGGCCGCGGGGCCCCTCAGG - Exonic
1180614897 22:17120678-17120700 CCGGGGCCGTCGGGGGCCCCGGG - Exonic
1180707343 22:17817762-17817784 GCGGGGCCTGGGGGCGCCTGAGG + Exonic
1181155410 22:20917219-20917241 CCTGGGCCGCTGCGCGCCGCTGG - Intergenic
1182623547 22:31630618-31630640 CCTTGTCCGCGGGGCTCCTCAGG + Intronic
1182718314 22:32377633-32377655 CCTGGGTCACGGGGAGCCTCAGG - Intronic
1183546038 22:38455305-38455327 CGCGGGCGGCGGGGCGCCCCGGG - Intergenic
1183824002 22:40370746-40370768 CGGGGGCTGCGGGGCGGCTGTGG + Intronic
1183956223 22:41382102-41382124 CCGGGGCCGGGGCGCGCAGCTGG + Exonic
1184640440 22:45867421-45867443 CCGGGGCTGCGGGACACCCCTGG - Intergenic
1184663670 22:45976792-45976814 CCGGGCCCGCGCGTCCCCTCCGG - Exonic
1184663769 22:45977150-45977172 CCGGGGCCGCGAGTCACCTGGGG - Intergenic
1184779168 22:46637748-46637770 CTGGGGCCCCTGGGCACCTCTGG + Intronic
1185317635 22:50185887-50185909 CTGGGGCCGCGGGGCGGGGCGGG - Intergenic
1185380342 22:50504940-50504962 CCGGGACCCACGGGCGCCTCTGG - Exonic
953349262 3:42202458-42202480 CCGGGGACGCCGGGCACCCCAGG + Exonic
954305698 3:49724206-49724228 CCGGGGCCGTGGGGCGGGGCCGG - Intergenic
960684748 3:120285231-120285253 CGCGGGGCGCCGGGCGCCTCTGG + Intergenic
961028917 3:123585122-123585144 CCAGGGCCGCGGGGCGGAGCCGG + Exonic
963852347 3:150221411-150221433 CCAGTGCCGCGGGGAGCCGCCGG - Intergenic
966096830 3:176213767-176213789 CCGGGGCTGCGCGGCGCTTGCGG - Intergenic
967087320 3:186107736-186107758 CCGGGCCCGCTGCGCGCCACAGG - Intronic
968382267 4:107391-107413 GCGGGGCTGCGGGGCGCGCCGGG - Intergenic
968492182 4:895889-895911 ACGGGGCCGAGGGGAGCCTCAGG + Intronic
968514720 4:1011367-1011389 CCGGGGGCGCGGCGAGGCTCGGG + Intronic
968965240 4:3766211-3766233 CCGGGACCGCGGGGCCGCTCAGG + Intergenic
969636984 4:8374987-8375009 GCAGGGCCGCGTGGCGGCTCAGG + Exonic
969721389 4:8894493-8894515 GCGGGGGTGGGGGGCGCCTCAGG + Intergenic
969873005 4:10116419-10116441 TGGGGGCAGCGGGGCTCCTCCGG + Intronic
972532965 4:39977301-39977323 CCCCGGCCGCTTGGCGCCTCCGG + Intronic
979349218 4:119627086-119627108 CCGGGGGCGCGGCGGGTCTCGGG - Intronic
984811103 4:183797366-183797388 GCGGGGCCGCTGGGCGCCCGGGG + Intergenic
985550201 5:528827-528849 CCGGGGCGGCGCGGTCCCTCCGG - Intergenic
985602543 5:842828-842850 CCGGGGTCGCCGGGAGCCACAGG - Intronic
985652401 5:1112932-1112954 CAGGGGCCGCGGGGCACTCCTGG - Intergenic
986333703 5:6736989-6737011 CCTGGGCCGCGGGGCCCCTGAGG + Intronic
988577926 5:32444551-32444573 CCCGGGCAGCGGGGAGCCGCGGG - Intronic
990376197 5:55173296-55173318 GCGGGGCCGCGGCGCGCGCCGGG - Intergenic
990557700 5:56952026-56952048 CGGGGGTCGCGGGGAGCCGCCGG + Intronic
992249969 5:74866555-74866577 CGGGGGCCGCGTGACGCCCCCGG - Intronic
992910736 5:81393954-81393976 CCGGGGCTGCGGGGAGGCGCGGG - Intronic
993500499 5:88661003-88661025 CCCGGGCCGCAGCGCGCCCCCGG + Intergenic
994171349 5:96662445-96662467 CCGGGGCCGCGGGGAGGCGGCGG - Exonic
994497846 5:100535750-100535772 GCGGGGCCGCGGGGCTCCGAGGG + Exonic
995745827 5:115402328-115402350 CAGGGGCCAAGGGGGGCCTCTGG + Intergenic
997235783 5:132271314-132271336 CCGGCTCCGCGGGAGGCCTCTGG - Exonic
999188437 5:149730158-149730180 GCGGGGCCGCGCGGCGCCCGCGG - Intergenic
999330762 5:150672060-150672082 CCTGGGGCGCGGCGCCCCTCCGG - Intronic
1001823037 5:174724735-174724757 CCGGGGCCTGGGGGCGCCGAGGG + Exonic
1002189975 5:177473132-177473154 CCGGGGCCGCGTGGCCCTGCGGG - Exonic
1002209836 5:177592089-177592111 CCAGGGCCGCGGGACATCTCGGG + Intergenic
1002638389 5:180619197-180619219 CCCCGGGCGCGGGGCGCCGCGGG - Intronic
1003593687 6:7456382-7456404 CCGGGGCTGCGCGGCGCTTGCGG + Intergenic
1006300924 6:33193168-33193190 TCGGGGACGTGGGCCGCCTCCGG + Intergenic
1007327467 6:41073237-41073259 CCGGGGCCTGCGAGCGCCTCGGG + Intronic
1007424021 6:41735375-41735397 CCGGAGCCGCGGGGCGCGGGCGG - Intronic
1007431513 6:41779903-41779925 CCGCGGCCGCGGGGCGGGGCGGG - Intronic
1007633495 6:43285228-43285250 CCGGGCCGGCGGGACGCCCCGGG - Exonic
1007644454 6:43369511-43369533 CCGGGCCCCCGGGGCGACGCGGG - Intergenic
1007656855 6:43455674-43455696 CCGGGGCCCCGGGGCGCGCCGGG - Intronic
1012930654 6:105312861-105312883 CCGGGGCTACGGGGCGGCACTGG + Intronic
1013694813 6:112689584-112689606 CCGGGGCGGTGGGGCCCCGCCGG + Intergenic
1015994830 6:138987494-138987516 CCGGGGCCGGCGGGCGGCTTAGG - Intronic
1016949664 6:149566991-149567013 CCGAGGCTGCGGGGCTCCGCCGG + Intronic
1017638957 6:156471743-156471765 CCAGGGCCACAGGGAGCCTCTGG - Intergenic
1017793637 6:157823069-157823091 CCGGGGCGGCGGCGCGGCGCGGG + Intronic
1017793779 6:157823513-157823535 CCGGGGCCGCGGGGAGGGTCGGG + Intronic
1018827524 6:167421077-167421099 CCGGGGGCCCGGGCCGGCTCAGG - Intergenic
1020016518 7:4834904-4834926 CCCGGGCCTTGGCGCGCCTCCGG - Exonic
1020130140 7:5555122-5555144 CCAGGGCCGCGAGGCGCTCCGGG + Intronic
1020418266 7:7969642-7969664 CTGGGGCCGCGGGCCGCGCCGGG - Exonic
1021315494 7:19143926-19143948 CCTGGGCCGCAGGGGGCCTTGGG - Intergenic
1026013494 7:66654678-66654700 GCGGGGCGGCCGGGCGTCTCGGG + Intronic
1026025484 7:66740845-66740867 GCGGGGCGGCGGGGCGTCTCGGG + Intronic
1026738847 7:72965905-72965927 CCGGGTCCCCAGGGAGCCTCAGG + Exonic
1026789856 7:73324535-73324557 CCGGGTCCCCAGGGAGCCTCAGG + Exonic
1027104887 7:75399164-75399186 CCGGGTCCCCAGGGAGCCTCAGG - Exonic
1029351380 7:100015542-100015564 CCGGGACCGCGCCGCGCTTCCGG - Intergenic
1029363239 7:100101651-100101673 CCGGGGCCGCAGGGCGGGGCAGG + Exonic
1030304148 7:108002595-108002617 CGGGGGCCGCGGGAGGCCGCAGG + Intronic
1031468631 7:122144006-122144028 CCGGCGCCGCGAGGCGACCCCGG - Intronic
1034284167 7:149873625-149873647 GCGGGTCCGCAGGGCGCTTCGGG + Exonic
1035538040 8:407190-407212 CCGGGGGCGGCGGGCGCGTCAGG + Intronic
1036688022 8:10924600-10924622 CCGGGGTGGCGGGGCGCGGCCGG + Intronic
1036739409 8:11347557-11347579 GAGGGGCCGCGTGGCGCCGCGGG - Intergenic
1039873563 8:41567195-41567217 CCGAGGCCGCGGCGCCCCTCGGG - Intergenic
1043854173 8:85245716-85245738 GCGGGACCGCGGGGCGCCGGCGG - Exonic
1044999808 8:97869420-97869442 CCGGGGCCCCGGGGCGCTGGGGG - Intronic
1047951478 8:129939411-129939433 CCGGGGCCGCGGGGCCACAGAGG + Intronic
1048618570 8:136106432-136106454 CCGGGGCTCCAGGGCTCCTCAGG - Intergenic
1049146091 8:141001695-141001717 GCGGGGCCGCAGGGCCGCTCAGG - Intronic
1049896128 9:113513-113535 CCGGCTCCGCGGGGCGGCGCGGG + Intergenic
1050151546 9:2622737-2622759 CCGGGGACGCGGAGCGCCAGGGG + Intronic
1051170629 9:14315515-14315537 GCGGGGCCGCGGCGCGCCCGGGG + Intronic
1057054477 9:91950122-91950144 CCGGAGCCGAGCGGCGCATCCGG - Exonic
1057488647 9:95506140-95506162 ACGGGGGCGCGGGGCCCCTCCGG - Intronic
1057708060 9:97412105-97412127 CCCAAGCCGCGGGGCGGCTCCGG + Exonic
1058618770 9:106862413-106862435 CCAGGGCTGCCGGGCGCCACCGG + Intergenic
1060514632 9:124258112-124258134 TCCGGGCCGCGGGGCCCCACCGG - Intronic
1060827466 9:126695224-126695246 CCGAGGCCGCTGGGAGCCGCTGG - Intronic
1060916948 9:127397478-127397500 CCGGGGGCGCGGCGCGCTGCAGG - Exonic
1061149101 9:128818847-128818869 CCCGGGCCGCGGGGTCCCCCGGG - Exonic
1061211414 9:129195548-129195570 TCCGGGCCGCAGGGCACCTCAGG + Intergenic
1061227534 9:129289372-129289394 CCTGGGCCCCAGGGCCCCTCTGG + Intergenic
1062012817 9:134275980-134276002 CTGGGGGGGCGGGGGGCCTCAGG + Intergenic
1062279228 9:135744581-135744603 CGTGGGCCTCGGGGAGCCTCGGG + Intronic
1062305839 9:135906934-135906956 CCGGGGCCGGGGGACGCGGCCGG - Intronic
1062334355 9:136058436-136058458 CCAGGGCCCTGGGGAGCCTCCGG - Intronic
1062351713 9:136142867-136142889 CCGAGCCCCCGGGGAGCCTCTGG - Intergenic
1062364730 9:136203219-136203241 GCGGGGCCGCGGGGCGGGGCGGG + Intronic
1062542042 9:137045837-137045859 CGCAGGCCGCGGGGCGCCCCGGG - Intronic
1062562655 9:137148548-137148570 CCGGGGCCGGGCTGCTCCTCAGG + Intronic
1185508228 X:644318-644340 CCGGGGGCGCGGGGCGGAGCAGG + Intronic
1187172991 X:16869988-16870010 CCGGGGCCGCGGGGGGCGGCGGG - Intronic
1187900908 X:24025754-24025776 GCCGGGACGCGGGGCGCCGCGGG - Intronic
1188736784 X:33726752-33726774 CGGGGGGCGCGGGGCGGCTGGGG + Intergenic
1191717703 X:64204871-64204893 CCTGGGCCTCCGGGCGCATCTGG - Intronic
1198214586 X:134545042-134545064 CCGGGCCGGCGGGGACCCTCAGG - Intergenic
1200138260 X:153885381-153885403 CCGGAGGCGTAGGGCGCCTCTGG - Intronic
1200233677 X:154458355-154458377 GCGGGGCCGCGGTGGGGCTCGGG + Exonic
1200239570 X:154486633-154486655 CCGGGGCGGCGGCGCGCGGCGGG - Exonic