ID: 933657184

View in Genome Browser
Species Human (GRCh38)
Location 2:84898698-84898720
Sequence CCCTTGGATTTCTCATTCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 370
Summary {0: 1, 1: 1, 2: 4, 3: 40, 4: 324}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933657184_933657190 -4 Left 933657184 2:84898698-84898720 CCCCAGAATGAGAAATCCAAGGG 0: 1
1: 1
2: 4
3: 40
4: 324
Right 933657190 2:84898717-84898739 AGGGAGAGAAGGACAGAGCCAGG 0: 1
1: 1
2: 17
3: 217
4: 1936
933657184_933657191 7 Left 933657184 2:84898698-84898720 CCCCAGAATGAGAAATCCAAGGG 0: 1
1: 1
2: 4
3: 40
4: 324
Right 933657191 2:84898728-84898750 GACAGAGCCAGGCACCAAAATGG 0: 1
1: 1
2: 1
3: 24
4: 262

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933657184 Original CRISPR CCCTTGGATTTCTCATTCTG GGG (reversed) Intronic
900669997 1:3846152-3846174 CACGTGGATGTCTCATTTTGAGG - Intronic
900892891 1:5462342-5462364 CTCTTGAATATTTCATTCTGGGG + Intergenic
902087997 1:13877880-13877902 CCCCAGGGTTTCTGATTCTGAGG - Intergenic
902272104 1:15312064-15312086 TCCTTGGATCACTCAGTCTGGGG - Intronic
902412445 1:16219337-16219359 CCCCTGGGTTGCTGATTCTGGGG - Intergenic
903362868 1:22787980-22788002 CTCTTGGCTCTCTCACTCTGGGG - Intronic
903555884 1:24193147-24193169 TCCTTGAACTTCTCAATCTGGGG - Intergenic
903998160 1:27321406-27321428 CCCTTGCCCTTTTCATTCTGTGG - Intergenic
904076632 1:27847799-27847821 CTCTCCCATTTCTCATTCTGTGG + Intronic
904285374 1:29450280-29450302 CCCTTGGAATGCTCCCTCTGGGG + Intergenic
905319390 1:37105157-37105179 CCATTGGATTTGACATTGTGGGG + Intergenic
905650102 1:39650564-39650586 CTCTTGGATTACTCACTCTCAGG + Intergenic
906373328 1:45273216-45273238 CTCTTGGATCACTCATTCAGGGG - Intronic
906554710 1:46699895-46699917 TCCTTGGATTAGTCACTCTGGGG + Intronic
907212850 1:52838195-52838217 CCATTGGATTTCCTACTCTGTGG + Intergenic
907431271 1:54413407-54413429 CCCATGGGTCTCTCATTCTGGGG + Intronic
907559986 1:55379432-55379454 TACCTGGAGTTCTCATTCTGTGG + Intergenic
908601608 1:65745327-65745349 CCAGTGGATCTATCATTCTGGGG - Intergenic
908869421 1:68591687-68591709 CAATTGGATTTCTAAGTCTGAGG - Intergenic
910640821 1:89459926-89459948 CACTTGGATTTCCTTTTCTGAGG - Intergenic
910823998 1:91386222-91386244 CTCTTAGATCTCTCACTCTGTGG + Intronic
912316592 1:108672355-108672377 CCCTTAGATTTCCCCTTTTGAGG - Intergenic
912323106 1:108733075-108733097 CCCATGGATTTCTGATTATGTGG + Intronic
915111056 1:153564943-153564965 CCCCTGGATATCTCAGTCTAGGG - Intronic
915264441 1:154706429-154706451 ACCATGACTTTCTCATTCTGAGG - Exonic
916067279 1:161146399-161146421 CCCTGGGATTTCTTATTTTATGG + Intergenic
916614990 1:166430177-166430199 CCCAGAGTTTTCTCATTCTGTGG - Intergenic
918787106 1:188776397-188776419 CCAGTGGATTTACCATTCTGGGG - Intergenic
919177169 1:194033440-194033462 CTAGTGGATTTATCATTCTGGGG + Intergenic
920783286 1:209015341-209015363 CTCTTGGATCACTCACTCTGGGG - Intergenic
920867596 1:209766192-209766214 TACCTGGATTTCTCAATCTGTGG + Intronic
921265006 1:213414940-213414962 CCCTGGGATTGCTGATTCTTTGG + Intergenic
921654815 1:217722062-217722084 CCCTTCTATTTCTCATTCCATGG + Intronic
922058358 1:222063529-222063551 CCAGTGGATTTACCATTCTGGGG + Intergenic
922349964 1:224727210-224727232 CCCATTGATTACTCAGTCTGGGG + Intronic
922610481 1:226923490-226923512 CCCTTGGCTTTCTGCCTCTGGGG - Intronic
923536092 1:234853027-234853049 CCCTTGGATTAGTGATTTTGCGG + Intergenic
923831012 1:237557219-237557241 CTCTTCGATTTTTCATTCTGGGG - Intronic
924739485 1:246786547-246786569 CCCTTGGATTTCCCACTAAGAGG + Intergenic
1067357621 10:45545238-45545260 CCTTTGTATCTCTCTTTCTGTGG + Intronic
1067395692 10:45914828-45914850 CCCTTGGATTGCTTGCTCTGGGG + Intergenic
1067805554 10:49390386-49390408 CGGTTGAAATTCTCATTCTGTGG - Intronic
1067864013 10:49883951-49883973 CCCTTGGATTGCTTGCTCTGGGG + Intronic
1068174741 10:53443789-53443811 CTCTTGGATTGTTCATTCTGTGG + Intergenic
1068317485 10:55365362-55365384 CCCTTGGATCATTCACTCTGTGG + Intronic
1069065336 10:63936624-63936646 ACCTTGGACTTCTCAGTCTCCGG + Intergenic
1072064613 10:91854131-91854153 ACTGTGGATTTCTCATTCTAGGG + Intronic
1072068197 10:91890642-91890664 TCCTTGTTTTTCTCATTTTGTGG + Intergenic
1072291484 10:93969645-93969667 CCCATGGATATCAAATTCTGAGG + Intergenic
1072877862 10:99192114-99192136 CTCTTAGATTTGTCATTTTGAGG - Intronic
1074224077 10:111466596-111466618 CTCTTGGATCACTCACTCTGGGG + Intergenic
1077531632 11:3099331-3099353 TCCTTGTGTTGCTCATTCTGTGG - Intronic
1078211342 11:9272337-9272359 CCCTTGGATATCTGATTCTTGGG - Intergenic
1078723793 11:13909431-13909453 CTTTTGGATTTCTTGTTCTGGGG + Intergenic
1079246347 11:18755090-18755112 CTCTTGGATCACTCACTCTGTGG + Intronic
1079720807 11:23811352-23811374 TCTTTGGATTTTTCAGTCTGGGG + Intergenic
1080873387 11:36256508-36256530 CTCTTGGATCACTCACTCTGAGG - Intergenic
1081309573 11:41553809-41553831 TCATTGGATCTATCATTCTGGGG - Intergenic
1081387436 11:42488283-42488305 CCCTTTGATTTTACTTTCTGTGG - Intergenic
1083012339 11:59415167-59415189 CCCATAGTTATCTCATTCTGTGG + Intergenic
1084082192 11:66835061-66835083 ACCTTGGATTTAACATTCTATGG - Intronic
1085798635 11:79566664-79566686 TCCTGAGCTTTCTCATTCTGCGG + Intergenic
1086733236 11:90274460-90274482 CTCTTTAATTTCTCATACTGTGG + Intergenic
1088567164 11:111184337-111184359 CCAGTGGATTTACCATTCTGGGG - Intergenic
1089031522 11:115334647-115334669 CCAGTGGATGTCTGATTCTGAGG - Intronic
1089212247 11:116813392-116813414 CTCTTGGATCACTCATTCTGAGG - Intergenic
1089642353 11:119856205-119856227 CTCTTGGATTGCTCGCTCTGGGG - Intergenic
1089994328 11:122890732-122890754 TCCTTGGTTTTCTCATTCAGAGG + Intronic
1090708100 11:129358137-129358159 CCCATGGATTTTTAATTTTGGGG + Intergenic
1091565757 12:1646802-1646824 ACCTTGGACTTCTCATTTTAGGG - Exonic
1092365847 12:7876325-7876347 CTCCTGGATTTCTCCTTGTGAGG + Intronic
1094064371 12:26347723-26347745 CCCCTTGATTTCTTCTTCTGGGG + Intronic
1094264509 12:28540830-28540852 CTCTTGGATTGCTTATTTTGGGG + Intronic
1095577052 12:43752323-43752345 TTCTTGGATTGCTCACTCTGGGG - Intronic
1096406625 12:51348523-51348545 CTCTTGGACTCCTCATCCTGGGG - Intergenic
1096519399 12:52175714-52175736 CCCTTGGGTGTCTCCTGCTGGGG + Intronic
1096624133 12:52883118-52883140 CCCTCGGATTTCTCACCCGGGGG + Intergenic
1098845221 12:75526706-75526728 CTCTGGGATCACTCATTCTGGGG + Intergenic
1099016929 12:77354447-77354469 CTCTTGCATTTTTCTTTCTGTGG + Intergenic
1099579473 12:84424965-84424987 CACCTGCATTTGTCATTCTGTGG + Intergenic
1100200268 12:92290638-92290660 CTCTTGGATTACTCTCTCTGGGG + Intergenic
1101758128 12:107637435-107637457 CCCTTGGAATTCTAATGCTTGGG - Intronic
1101912129 12:108867905-108867927 CTCTTGGATTTCTCATTCTGGGG + Intronic
1102783559 12:115585630-115585652 CCCATGGACTTCCCATCCTGTGG + Intergenic
1105893632 13:24699786-24699808 TCCTTGAATTTGTCATTCTGTGG - Intronic
1106698965 13:32208695-32208717 GCCTTGGTTTTATCATTCTGTGG + Intronic
1106777696 13:33024691-33024713 CTCTTTGATTTCTCATCATGTGG + Intronic
1107621507 13:42236076-42236098 CCTTTGGATTTCTCTATGTGAGG + Intronic
1109407291 13:61918642-61918664 TCATTGGATCTCCCATTCTGGGG + Intergenic
1110150002 13:72239882-72239904 ACCTTGAATCACTCATTCTGTGG + Intergenic
1110956043 13:81553477-81553499 CCCTCCCATTTCTCTTTCTGCGG + Intergenic
1111130493 13:83968984-83969006 CTCTTGGATTTTCCATTTTGAGG - Intergenic
1111395955 13:87671287-87671309 CCCTTGGATGTCACATTCGTAGG - Intergenic
1111705158 13:91739689-91739711 CTCTTAGATTTCTTGTTCTGAGG - Intronic
1112656893 13:101461138-101461160 TCCTTTCCTTTCTCATTCTGGGG - Intronic
1113073544 13:106446186-106446208 CCCTTGAATTACTCATCCCGGGG - Intergenic
1113230250 13:108205961-108205983 CCCTTGGAATTCTCACTTTTGGG - Intergenic
1114665876 14:24376797-24376819 CCCCTGGATTTCTCCTGCTCCGG - Exonic
1114783576 14:25568915-25568937 CTCTTAGATTTGTCATTTTGGGG + Intergenic
1115937191 14:38565643-38565665 TCCTTGGCTTTGTCTTTCTGTGG + Intergenic
1116195125 14:41715758-41715780 TCGTTGGATCTATCATTCTGGGG + Intronic
1116412897 14:44646606-44646628 TCCTTGGATGGCTCATTCTGAGG + Intergenic
1116420440 14:44726366-44726388 CCCTTGAATCACTCATTCTACGG + Intergenic
1116801378 14:49447576-49447598 CCCTTAGTTTTATAATTCTGTGG - Intergenic
1117013666 14:51496099-51496121 CTCTTGGATCACTCACTCTGAGG + Intronic
1117398607 14:55337313-55337335 CTCTAGCATTTCTCATTCTATGG + Intronic
1118280354 14:64422745-64422767 CCCTAGAATTTCTCTTTCTTTGG - Intronic
1118539436 14:66805869-66805891 TCATTGGATCTATCATTCTGGGG + Intronic
1119586121 14:75837315-75837337 CTGTTGAATTACTCATTCTGAGG - Intronic
1120194583 14:81467946-81467968 CTCTTGGAGTGCTCACTCTGAGG + Intergenic
1120989420 14:90362133-90362155 CCCTTCTATTTTTCCTTCTGAGG - Intergenic
1121111603 14:91316788-91316810 CCCTCATCTTTCTCATTCTGTGG + Intronic
1121215369 14:92243638-92243660 CTCTTGGATTACTTAGTCTGGGG - Intergenic
1122363784 14:101182666-101182688 CCATTAGATCTCTCACTCTGGGG - Intergenic
1123877954 15:24642813-24642835 CCCTTGCTTTCCTCAGTCTGGGG + Intergenic
1125119177 15:36132668-36132690 CCCTTTGCTTTCTCATAGTGAGG + Intergenic
1126076561 15:44916909-44916931 TTCTTGGATTTTTCACTCTGAGG + Intergenic
1126082336 15:44976475-44976497 TTCTTGGATTTTTCACTCTGAGG - Intronic
1128686450 15:69689848-69689870 CTCTTGGATTGCTCCCTCTGAGG + Intergenic
1129889741 15:79064011-79064033 ACCTTGGTTTTCTCATCCAGAGG - Intronic
1130560928 15:84958364-84958386 CCCTTGTCTTTCTCTTTCTTGGG + Intergenic
1131029095 15:89171299-89171321 CCCTTGAGTTTCTGATTCCGTGG + Intronic
1132712513 16:1275876-1275898 CCCTTGGTTTGCACATTCTGGGG - Intergenic
1135163173 16:20115578-20115600 CTCTTGGATCACTCACTCTGGGG - Intergenic
1136571302 16:31098774-31098796 CTCTTAGATCACTCATTCTGGGG - Intergenic
1137505315 16:49049402-49049424 CCCTCGGATTTCTCCTCCAGAGG - Intergenic
1137537822 16:49340816-49340838 CACCTGGAGTTCTCATTCTCAGG - Intergenic
1138170516 16:54844949-54844971 CTCTTGGATCACTCATTTTGGGG - Intergenic
1138540177 16:57683044-57683066 CCCTTGGAGGTTTCCTTCTGGGG - Intronic
1138707753 16:58935078-58935100 CCCTGGAGTTTCTGATTCTGTGG - Intergenic
1138859550 16:60740108-60740130 ACCTTGGGTTTCTCACCCTGAGG - Intergenic
1140024616 16:71274429-71274451 CTATTTGATTTATCATTCTGTGG - Intergenic
1141550660 16:84804621-84804643 GGCTTGGATATATCATTCTGGGG - Intergenic
1203113441 16_KI270728v1_random:1466924-1466946 GCCTTGGTTTTCTCATCCAGGGG + Intergenic
1143064076 17:4229791-4229813 CTTTTGGATTGCTCATTTTGGGG - Intronic
1143447699 17:7018814-7018836 CCCTTGGATTTTGCTTTCTGAGG - Intergenic
1144555887 17:16282549-16282571 CCCTAGAATTACTCTTTCTGAGG + Intronic
1146074868 17:29718913-29718935 CCCTGGGATCACTCATTCTGGGG - Intronic
1147442256 17:40454344-40454366 CCCCTGGATTTCACCATCTGTGG + Intronic
1148822895 17:50370749-50370771 TCCTTGGCTTTCTCCTTTTGGGG + Intronic
1151189671 17:72389021-72389043 GCCTAGAATTTGTCATTCTGCGG + Intergenic
1151720251 17:75851113-75851135 GCCTGGCATTTGTCATTCTGCGG + Intronic
1151902073 17:77022896-77022918 CCAGTGGATTTACCATTCTGTGG - Intergenic
1152989976 18:354469-354491 CCTTTCGATTTCTCCTTCAGAGG + Intronic
1154111555 18:11572789-11572811 CCCTAGTATTTTTCATCCTGCGG + Intergenic
1155707795 18:28837999-28838021 TCGGTGGATTTATCATTCTGGGG + Intergenic
1155834572 18:30564649-30564671 CCCTTGGGTTTATGAATCTGTGG + Intergenic
1158212613 18:55068005-55068027 CTCTTGGAATACTCATTTTGGGG + Intergenic
1159012863 18:63074768-63074790 CCTTTGGATTTCTGCTTCTGAGG + Intergenic
1159991996 18:74919830-74919852 GGCTTGCATTTCTAATTCTGCGG + Intronic
1161185015 19:2911801-2911823 CCCATGGCTTTTTCATTCTTAGG + Intronic
1162015073 19:7841275-7841297 CCCTTGGGGATCTCATTCTTGGG - Intronic
1163362025 19:16852793-16852815 CCCTTGCCTTTCTGATGCTGTGG + Intronic
1164940016 19:32244837-32244859 CCCTTGAGTTTCTCAAACTGAGG + Intergenic
1165149259 19:33751345-33751367 CCCTTGGATGTCTACGTCTGAGG - Intronic
1165547022 19:36547695-36547717 CACTTTGAATGCTCATTCTGTGG - Exonic
1166388382 19:42395219-42395241 ATCTTGCATTTCTGATTCTGAGG + Intergenic
925497842 2:4472144-4472166 CCCTTGGATTTCTCTAACTTAGG + Intergenic
925669201 2:6293311-6293333 TCCATGGATCTATCATTCTGGGG - Intergenic
926695912 2:15770200-15770222 CCCTTCCATTTCTCTTTCAGAGG + Intergenic
926881538 2:17550403-17550425 CCTCTGGATTTCTCATGCTCTGG + Intronic
927947592 2:27146403-27146425 CTCTTGGATCGCTCACTCTGGGG - Intergenic
928360098 2:30655786-30655808 CCCTTGGATTCCTTGTTCTGTGG + Intergenic
928783745 2:34855931-34855953 CCCTTAGATTTGCCATTTTGAGG - Intergenic
929258837 2:39842447-39842469 CCTTTTGTTTTCTCATTATGAGG + Intergenic
929458041 2:42080042-42080064 CTTGTGGATTTCTCATTTTGTGG - Intergenic
929635511 2:43516884-43516906 CCTTTGGAATTTTTATTCTGCGG - Intronic
929670101 2:43869952-43869974 ACGTTGGAATTCTCACTCTGTGG + Intronic
930751912 2:54942796-54942818 CCTCTGGATTTCTCATTCCCGGG + Intronic
931190990 2:60000041-60000063 CCCTGGAATTTCTCTTTCAGGGG + Intergenic
931971037 2:67586627-67586649 CACATGCATTTGTCATTCTGGGG + Intergenic
932326547 2:70865911-70865933 CCTTAGCATTTCTCATTCTTTGG - Intergenic
932559402 2:72854173-72854195 CTCTTGGTTTTCTCAATCTGTGG + Intergenic
933657184 2:84898698-84898720 CCCTTGGATTTCTCATTCTGGGG - Intronic
933748955 2:85590978-85591000 CTCTTGGATTTCCCAGCCTGGGG - Intronic
934070039 2:88375350-88375372 CTCTTGGATCACTCCTTCTGGGG - Intergenic
934607916 2:95712009-95712031 GCCTTGGATCACTCACTCTGTGG - Intergenic
934887026 2:98033795-98033817 CCCTTGGCTTTGTGATTTTGAGG - Intergenic
935694602 2:105760583-105760605 CTCTTGGATCTCTCCATCTGAGG + Intronic
936350306 2:111707293-111707315 CTCCTGGATTGCTCAATCTGTGG + Intergenic
936541260 2:113353897-113353919 GCCTTGGATCACTCACTCTGTGG - Intergenic
937225600 2:120367117-120367139 CCATTGGATTTCCCATGCTCAGG + Intergenic
937547989 2:123048324-123048346 CTCTTGGATTTCTGACTGTGGGG - Intergenic
939043598 2:137222924-137222946 CCCTGGCCTCTCTCATTCTGTGG + Intronic
939083747 2:137692393-137692415 CTCTTAGATTGCTCACTCTGAGG + Intergenic
939174747 2:138736115-138736137 CCAGTGGATCTATCATTCTGGGG + Intronic
939364682 2:141216539-141216561 CCAGTGGCTCTCTCATTCTGGGG - Intronic
939752389 2:146063868-146063890 TCCGTGGATCTATCATTCTGGGG + Intergenic
941176146 2:162199570-162199592 CACATGGAATTCTGATTCTGAGG - Intronic
943687704 2:190836611-190836633 CCCTAGGAGTTATCAATCTGTGG + Intergenic
944685819 2:202116871-202116893 CTCTCGGATTACTCACTCTGGGG + Intronic
944740546 2:202607904-202607926 TCCTTGGATCTCTGATCCTGAGG - Intergenic
945855069 2:215059153-215059175 CCCATGTAATTCTAATTCTGGGG - Intronic
947672114 2:231944289-231944311 CCCTTGGATTTCTGATGCACAGG - Intergenic
948279668 2:236737482-236737504 CCCTTGGACTTCTCATCTTTGGG - Intergenic
948658837 2:239494164-239494186 CCCTTGACTTTCTCATCCTGAGG + Intergenic
949007621 2:241658587-241658609 GCCTTGGATTTCCCCTTCTGAGG - Intronic
1169442150 20:5641524-5641546 CTCTTGGATTGCTTACTCTGAGG - Intergenic
1169817698 20:9675123-9675145 GCCTTGCAATTCTCAGTCTGAGG - Intronic
1170776166 20:19376551-19376573 CCCTTGGCTGGCTCATGCTGGGG - Intronic
1171482225 20:25462525-25462547 TCCTTGTAGTTCTGATTCTGGGG + Exonic
1173423736 20:42925698-42925720 CCCTTGGGTTTCTGATTCAGTGG + Intronic
1173889849 20:46498333-46498355 GCTTTGGATCACTCATTCTGAGG + Intergenic
1174125379 20:48300727-48300749 TCCTTTGATTTCTGAGTCTGTGG - Intergenic
1175265559 20:57701384-57701406 CCCTAGGAATTCTCCTTCTGGGG + Intronic
1175674325 20:60933876-60933898 CTCTTGATTTTCTCATTCTTTGG + Intergenic
1177474066 21:21595329-21595351 CTCTCAGATTTCTTATTCTGGGG + Intergenic
1177890685 21:26800408-26800430 CCCTTGGATAGCTCACCCTGCGG + Intergenic
1178112374 21:29381613-29381635 CCCTAGAGTTTCTGATTCTGTGG + Intronic
1178205192 21:30456497-30456519 CCCATGGATCTACCATTCTGGGG + Intergenic
1178322896 21:31619231-31619253 CTCTTGGATTACTCATTCTGAGG + Intergenic
1182087641 22:27572425-27572447 CTCTTGGATCACGCATTCTGGGG + Intergenic
1182254527 22:29028884-29028906 CCCTTGGACTCCTCACCCTGTGG - Intronic
1182740240 22:32562303-32562325 CCCTTGGCTTTGTCAGGCTGAGG + Intronic
1182947798 22:34340948-34340970 CCCAGGAGTTTCTCATTCTGGGG + Intergenic
1183365342 22:37403831-37403853 CCCAAGGCTCTCTCATTCTGGGG - Intronic
951026036 3:17831202-17831224 CCCTTGGATTTCTCACTCTAGGG + Intronic
951125124 3:18975582-18975604 CTCTTAGATTTGTCCTTCTGAGG + Intergenic
952105496 3:30065358-30065380 TCCATGGATCTATCATTCTGGGG + Intergenic
952610110 3:35198626-35198648 CTCTAGGATATTTCATTCTGTGG - Intergenic
953154705 3:40359139-40359161 CCCCTGGATTTATCCTTGTGAGG - Intergenic
953385862 3:42505330-42505352 CCCTGGGACTCCTCCTTCTGGGG - Intronic
953603907 3:44395506-44395528 ACCTTGGAATTCTAATTCTGTGG - Intronic
954012521 3:47654603-47654625 CCCTTGAACTTCTAAGTCTGTGG - Intronic
954318157 3:49812517-49812539 CCCCTGGCATTCTCACTCTGAGG - Exonic
954588807 3:51762477-51762499 ATCTGGGATTGCTCATTCTGGGG + Intergenic
954924406 3:54219545-54219567 CCCTTGGGTTTCTCTTCCTTCGG + Intronic
955681706 3:61508151-61508173 TCCTTGGGTTTCTCATGCTTGGG + Intergenic
957354793 3:79067996-79068018 CTCTTGGATCACTCACTCTGGGG - Intronic
958140573 3:89557283-89557305 ACATTGCATTTCTCCTTCTGAGG - Intergenic
959950323 3:112174325-112174347 CCTTAGGATTTTTCATGCTGGGG + Intronic
960471676 3:118074178-118074200 CTCTTGGATTTGTCTTTTTGAGG + Intergenic
961810742 3:129520169-129520191 CCCTTAGATGTTCCATTCTGAGG + Exonic
961912546 3:130334687-130334709 CCCTTGGGTTCCTCACTGTGTGG + Intergenic
962452457 3:135531903-135531925 TCCTTGTACTTTTCATTCTGTGG - Intergenic
963071884 3:141311489-141311511 CCCTTGGATGCCTCGTTCTCTGG + Intergenic
963374827 3:144450497-144450519 CCCATGAATTTCTCTTTCTCAGG - Intergenic
963635623 3:147791981-147792003 ACTTTGGACTTCTCATTCTCTGG - Intergenic
964116986 3:153146860-153146882 CTCTTGCATTTCCCACTCTGGGG - Intergenic
964271033 3:154957044-154957066 CCCTTTGGTTTCTCATCCTCTGG + Intergenic
964739317 3:159948996-159949018 CTCTTGGATCACTCACTCTGGGG + Intergenic
965051149 3:163648945-163648967 CCATTGGATCTATCATTCTTGGG + Intergenic
965074968 3:163964267-163964289 CCAATGGATTTACCATTCTGGGG - Intergenic
965388436 3:168074034-168074056 GTCTGGGATTCCTCATTCTGTGG + Intronic
966545353 3:181140326-181140348 CTTTTGTATTTCTCATTCTTTGG + Intergenic
967290948 3:187919756-187919778 CCATTGCTTTTCTCATTGTGAGG - Intergenic
967653530 3:192016780-192016802 CCCTGGGACTTCTCAGTCTTTGG - Intergenic
968093198 3:195910340-195910362 CGCTGGGTTTTCTCCTTCTGGGG - Intronic
972088680 4:35253345-35253367 CCCTTGGATTTCTGGACCTGTGG + Intergenic
972149080 4:36065684-36065706 CCCTTGGCCTTCTCATGGTGTGG + Intronic
972565655 4:40266845-40266867 CCCTTGGCTTTGTGATTTTGGGG + Intergenic
973158193 4:46984137-46984159 CCCTAGGTTTTCTCATGATGTGG - Intronic
974696031 4:65373132-65373154 CTATTGGATTTCTCAATCTGAGG + Intronic
975147121 4:70980631-70980653 CCTATGGATTCCTCACTCTGTGG - Intronic
976817236 4:89163197-89163219 CTTTTGCATTGCTCATTCTGGGG - Intergenic
978476480 4:109136873-109136895 TCCATGGATCTCTCACTCTGGGG + Intronic
979100114 4:116602482-116602504 CCCTTAGATTTGCCATTTTGAGG + Intergenic
979367980 4:119848109-119848131 CCGGTGGATTTACCATTCTGGGG + Intergenic
979607053 4:122649690-122649712 CTCTTGGATTGCTCACTCTGTGG - Intergenic
980101577 4:128546712-128546734 GCCTTGGATTTCTTTTTCAGAGG + Intergenic
981041810 4:140230118-140230140 TACTTGGATTTATGATTCTGAGG + Intergenic
982428817 4:155298432-155298454 CCAGTGGATCTCCCATTCTGAGG + Intergenic
982660561 4:158201575-158201597 TTCTTGGATTTCTCACTCTGTGG + Intergenic
982766804 4:159358211-159358233 GCCTTGGAACTCACATTCTGAGG + Exonic
983414081 4:167433905-167433927 CCCATGTATTTTTGATTCTGAGG - Intergenic
987588608 5:19892657-19892679 CTCTTGGATTGTTCACTCTGTGG + Intronic
988100753 5:26674371-26674393 CCCTTTCATTTCTAATTTTGAGG - Intergenic
989329532 5:40240188-40240210 CCCTTGGATCACCCACTCTGGGG + Intergenic
989611364 5:43295915-43295937 TCCTTGGACTTCTCTTTCAGAGG - Exonic
989774462 5:45186688-45186710 CCCTAGAATTTCTGATTCAGTGG + Intergenic
990370091 5:55109120-55109142 CCTTTGGATTTCTCAGTCTCTGG - Intronic
990531537 5:56678738-56678760 ACGATGGATTTCTCATTCTAAGG - Intergenic
991005673 5:61825701-61825723 TCCTTGGATTGCTTATCCTGGGG - Intergenic
991502646 5:67292384-67292406 CCTTTAGATTTCTCATTCCAAGG + Intergenic
992185520 5:74240871-74240893 ACCTTGGATCTGTCATGCTGTGG - Intergenic
992313845 5:75532010-75532032 CTCTTGGATTACTAACTCTGGGG - Intronic
992448547 5:76855278-76855300 TCCTTGTATTTACCATTCTGGGG - Intronic
992723693 5:79585215-79585237 CATTCTGATTTCTCATTCTGGGG + Intergenic
994274555 5:97820786-97820808 CTCTTAGATTTGTCCTTCTGAGG + Intergenic
994658703 5:102627151-102627173 CCCTTGGCTATCTCATTCCTTGG + Intergenic
995013633 5:107285986-107286008 CCTTTGGATTTAGCCTTCTGTGG - Intergenic
996034076 5:118738749-118738771 CCCCAGGACTTCTTATTCTGTGG - Intergenic
999611956 5:153379333-153379355 CTCTTGGATTACACACTCTGGGG + Intergenic
999926825 5:156388080-156388102 AAGTTGGATTTCACATTCTGAGG + Intronic
1001533843 5:172484056-172484078 CCCTTGGGTTGCTTATTCTGGGG + Intergenic
1001962680 5:175889585-175889607 CTCTTGGATTACTCACTCTGGGG - Intergenic
1003210406 6:4059202-4059224 CAGTTGGATTTGTCATTCTGAGG - Intronic
1005142563 6:22650027-22650049 CCCTCGAATTTCTCAGTCTGTGG + Intergenic
1005290809 6:24376918-24376940 ACCTTGGAGATCCCATTCTGAGG + Intergenic
1007946232 6:45829556-45829578 CGCTTGGAATTCTCACTCTTGGG - Intergenic
1010458158 6:76082694-76082716 TCATTGGATTTACCATTCTGGGG + Intergenic
1012424260 6:99096705-99096727 GCCTTGCATTTCTCAATCTCAGG - Intergenic
1013431019 6:110054889-110054911 CCCTGGGGTTCCTCATGCTGGGG - Intergenic
1015563981 6:134546821-134546843 CCCTTGGATTCTTCAATATGAGG + Intergenic
1016870521 6:148811724-148811746 CCCTTGGGACACTCATTCTGAGG - Intronic
1017109633 6:150920094-150920116 CCCTTGGATTGCTCACACTGGGG - Intronic
1017325478 6:153136646-153136668 CCCTTGAATTTCCCAGCCTGTGG + Intergenic
1019636624 7:2079393-2079415 CCTTTGGTCTTCTCATTCTCTGG - Intronic
1019882231 7:3871975-3871997 CCCTTCAATTTCTCATTTTCTGG + Intronic
1021317907 7:19173061-19173083 CTCTTGGAATGCTCATTCTGAGG + Intergenic
1021646659 7:22795862-22795884 CCAGTGGATCTATCATTCTGGGG + Intergenic
1021778893 7:24082574-24082596 CCAGTGGATTTACCATTCTGTGG + Intergenic
1022764053 7:33390133-33390155 CACTTTTCTTTCTCATTCTGGGG + Intronic
1022862037 7:34377275-34377297 CCTATGGCTTTTTCATTCTGAGG - Intergenic
1022990394 7:35701566-35701588 CTTTTGGATCTCTCATTCTGGGG - Intergenic
1023282029 7:38580630-38580652 CTCTTGGACTTCTCATCCTCAGG - Intronic
1023519981 7:41040176-41040198 TTCTTGGATTGCTGATTCTGAGG + Intergenic
1023592651 7:41795919-41795941 CTCCAGAATTTCTCATTCTGTGG - Intergenic
1023714244 7:43026964-43026986 TCTTTGTATTTCACATTCTGGGG - Intergenic
1024958986 7:54955805-54955827 CCCTGGGATTTCTTTTTCTCTGG + Intergenic
1026561900 7:71457341-71457363 CCCTTGGCTTTGTGATTCTGGGG + Intronic
1027781709 7:82528444-82528466 CTTTTGGATTGCTCATTCTATGG - Intergenic
1028222369 7:88212812-88212834 CCCTAGAGTTTCTCATTCAGAGG - Intronic
1028645867 7:93096038-93096060 CCCTGGGCTTTCTCCTTGTGGGG + Intergenic
1030481648 7:110111908-110111930 CCTTTGGATATCTCATCCTAAGG + Intergenic
1030986160 7:116244608-116244630 TCCTTGGATCTCCCATTCTGGGG + Intronic
1031184161 7:118454769-118454791 CCCCTGGAATTTGCATTCTGCGG + Intergenic
1033261997 7:139851981-139852003 CCCTTGGATTGCTTACTTTGGGG + Intronic
1034126044 7:148672362-148672384 CCCTTGGATTTCTCTCTCTGAGG - Intergenic
1034180945 7:149137323-149137345 TCCTTGCCTTTCTCAATCTGAGG + Intronic
1034733486 7:153408861-153408883 GTCTTGGATTCCTCACTCTGGGG + Intergenic
1035082283 7:156226804-156226826 CTCTTCTATTTCTAATTCTGCGG - Intergenic
1035126723 7:156613212-156613234 ACCTTTGATTTCTCAGTCAGCGG - Intergenic
1038282399 8:26177906-26177928 CTCTTGGATGGCTCCTTCTGGGG - Intergenic
1039596726 8:38797151-38797173 CTCTTGGATCACTCACTCTGGGG - Intronic
1042052585 8:64727168-64727190 CCCTGGGAGTTCTACTTCTGAGG + Intronic
1042256536 8:66809941-66809963 CTCTTGGATCCCTCACTCTGGGG - Intronic
1043489295 8:80732460-80732482 TGCTTGGATTTCTAGTTCTGAGG + Intronic
1043567511 8:81563798-81563820 CTCTTAGATTTGTCATTTTGAGG - Intergenic
1044515696 8:93135910-93135932 CTCTTGGATTGCTCTCTCTGGGG - Intronic
1045317230 8:101053650-101053672 CTCTTGGATCAATCATTCTGGGG + Intergenic
1046074115 8:109296810-109296832 CTCTTGGATCACACATTCTGAGG + Intronic
1046649158 8:116818055-116818077 TCACTGGATTTCTCAGTCTGAGG + Intronic
1047902863 8:129442828-129442850 GCCTTGGCTTCCTCATTGTGGGG - Intergenic
1047974934 8:130120743-130120765 CCCTTAGGTCTCTAATTCTGTGG + Intronic
1048036023 8:130677876-130677898 TCCGTGCATCTCTCATTCTGGGG - Intergenic
1048738866 8:137532112-137532134 CCAGTGGATTTACCATTCTGGGG - Intergenic
1049973319 9:840193-840215 CCTTTGGAGCTCTAATTCTGAGG - Intergenic
1051349490 9:16185512-16185534 ACCTTGGATTACTCACTCTGGGG - Intergenic
1053060612 9:35028279-35028301 CCCTTGGATTAGTGATTTTGAGG + Intergenic
1053536439 9:38931159-38931181 CCCTTGGCTTACTAATTTTGGGG + Intergenic
1054629695 9:67432789-67432811 CCCTTGGCTTACTAATTTTGGGG - Intergenic
1054812120 9:69443195-69443217 CCCTAGGTTTTCTGATTCAGTGG - Intronic
1056793838 9:89642967-89642989 CTCTTGGTTTTCTCACTCTGTGG + Intergenic
1056925737 9:90833082-90833104 CTTTTGGATTGCTCACTCTGGGG - Intronic
1057940386 9:99276968-99276990 CTCTTTGATTTCTAATTCAGGGG - Intergenic
1058132507 9:101268633-101268655 GCCTTGGATTAGTCATTCTGGGG + Intronic
1059983316 9:119797202-119797224 ACCTTGGATTTTTAGTTCTGTGG + Intergenic
1062219283 9:135405701-135405723 CCCTTGGAATACTCATTCTGTGG - Intergenic
1185549700 X:973201-973223 CCCTTGGCCTTCTGATCCTGGGG - Intergenic
1187080875 X:15986152-15986174 CTCTTGGATCACTCACTCTGGGG - Intergenic
1187309703 X:18130066-18130088 GCCTTGGATTGCTCCTTCTGGGG - Intergenic
1187855318 X:23631412-23631434 CACTGGGATTACTCATTCTGGGG - Intergenic
1187858818 X:23662932-23662954 TGCTTAGATTACTCATTCTGGGG - Intergenic
1188433864 X:30138487-30138509 CACTTGGCCTTCTCATTCTAAGG + Intergenic
1188924458 X:36022600-36022622 CTCTTAGATTTGTCCTTCTGAGG + Intergenic
1189257058 X:39648515-39648537 CCCTTGTATTTCCCATTAAGAGG + Intergenic
1189534243 X:41920991-41921013 TCCTTGGTTTCCTCATTCTTAGG - Intronic
1189566620 X:42248088-42248110 CCCTAGGACTTCTCATTTTAAGG + Intergenic
1189733644 X:44047727-44047749 CTCTAGGATTTCTCTGTCTGTGG - Intergenic
1190465947 X:50725199-50725221 CCAGTGGATTTCCCCTTCTGGGG - Intronic
1191735476 X:64384331-64384353 CCAGTGGATCTCCCATTCTGTGG + Intronic
1192033704 X:67542945-67542967 TCCTTTGACTTCTGATTCTGGGG - Intergenic
1192256443 X:69464388-69464410 CTCTTTGCTTTCTCTTTCTGGGG + Intergenic
1193204694 X:78735000-78735022 CTCTTGGATTTGTCCTTCTGAGG + Intergenic
1193706373 X:84824697-84824719 CCCTTTGATTTCTCTCTCTCTGG - Intergenic
1196762987 X:119216621-119216643 CTTTTGCATTTCTCATTATGAGG - Intergenic
1197472716 X:126882834-126882856 CCAGTGGATTTACCATTCTGGGG - Intergenic
1198502120 X:137260599-137260621 CTCTTGGATTGCTCACTCTAGGG - Intergenic
1199261465 X:145780086-145780108 CCAGTGGATTTTCCATTCTGGGG - Intergenic