ID: 933660240

View in Genome Browser
Species Human (GRCh38)
Location 2:84921543-84921565
Sequence GATAAGAATTCCTGTCCTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933660240_933660243 6 Left 933660240 2:84921543-84921565 CCTGTAGGACAGGAATTCTTATC No data
Right 933660243 2:84921572-84921594 CAGATAGCAAAATCCAGAGATGG No data
933660240_933660245 28 Left 933660240 2:84921543-84921565 CCTGTAGGACAGGAATTCTTATC No data
Right 933660245 2:84921594-84921616 GTCAAATCCCTGCTATAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933660240 Original CRISPR GATAAGAATTCCTGTCCTAC AGG (reversed) Intergenic
No off target data available for this crispr