ID: 933663566

View in Genome Browser
Species Human (GRCh38)
Location 2:84946614-84946636
Sequence ACCACGGAGGTGAGTGCAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933663566_933663569 -8 Left 933663566 2:84946614-84946636 CCACTTGCACTCACCTCCGTGGT No data
Right 933663569 2:84946629-84946651 TCCGTGGTGCACGTATTCCAGGG No data
933663566_933663568 -9 Left 933663566 2:84946614-84946636 CCACTTGCACTCACCTCCGTGGT No data
Right 933663568 2:84946628-84946650 CTCCGTGGTGCACGTATTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933663566 Original CRISPR ACCACGGAGGTGAGTGCAAG TGG (reversed) Intergenic
No off target data available for this crispr