ID: 933665735

View in Genome Browser
Species Human (GRCh38)
Location 2:84963411-84963433
Sequence GCTGTTTTTGTATCCCCTAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933665735_933665738 28 Left 933665735 2:84963411-84963433 CCAATAGGGGATACAAAAACAGC No data
Right 933665738 2:84963462-84963484 TGGTATCCCAGAAAATGAGAGGG No data
933665735_933665736 8 Left 933665735 2:84963411-84963433 CCAATAGGGGATACAAAAACAGC No data
Right 933665736 2:84963442-84963464 GAAAGAGAAGATGATGATAGTGG No data
933665735_933665737 27 Left 933665735 2:84963411-84963433 CCAATAGGGGATACAAAAACAGC No data
Right 933665737 2:84963461-84963483 GTGGTATCCCAGAAAATGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933665735 Original CRISPR GCTGTTTTTGTATCCCCTAT TGG (reversed) Intergenic
No off target data available for this crispr